Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1605
Length(NT) : 901
Best Gene Model Blast : Link to GSTUMT00006611001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CC1G_05615
Accession: gb|EAU83711.1| Score: 339 E_value: 2e-49
KEGG Definition: hypothetical protein
Accession: ncr:NCU07352.1 Score: 213 E_value: 6e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1605
TTGGCATCGTTCCACGCTTTGTCACAGAAATCCCGACCGCCTCTCCATCC
CCGTGGAAAATTCTTCCGCACTGGGCGGGATGACTAATCTTCGCGGGCCA
ATTGGGTTTGTTCCGATTGTTCTGCGATGGCGGCGGGGAGCGACAGCCGG
GTACCCGTATCGTGGGTGGTCGAGTAGGGATATAAAATGGGGGGAATCCG
CGACATATTTTGCTGACAGCATGATATTGCTGGGATTTGATTTCCTCTTT
TCATAAAAAACCTTTACCCCACACCACTTCACGATATACTGCAGCAAGCA
GAGATGCAGTCCATAGATCCAAAATCCCTCTCAACCCTCCAAGCCCGCGT
CGCCTACTTGAAATCCTTCATAGGCTTCACCCAAGCCGATGCCGCGGCCC
TCCACGGTGCGAGACCCGTCGTGGAAGCGCTCATCCCCACAATCGTCGAT
GCGGTCTACAAGAAACTCCTGAGCTTCGACATCACCGCGAAAGCATTCGT
GCCCAGACAGACCGGCTACGATGGCGTCGCGCCGACAAAGGTGGAGGAAT
TGAATCTGGAGCACCCGATGGTCAAGTTCCGGATGGGCTTTCTGAAGGGA
TATTTGAAGAAGTTGGTTGTGGTCGATTACGACGATTTGGGGACTTGGGT
ATGTGGTAATTTTTTTAAAGAGTATTATTTGGGGGAGGGGGCTAACTTGC
TTCGCAGGAGTACTTTGATAAAGTCGGGATTATGCACACTGGTGTTGCGG
GGTTCGCTCACAGGGCAAAGAAACCCGGCCTCCGCGTCGAGTACATCCAC
ATGGGGCTTCTCCTCGGCTACGTCGTCGACCTGGTGATTGCGGCGGTCCT
GGCTCGCCCGGACCTGGATAACGAGACGAGGAGCGCCGTTTTGACGGCGT
T

Sequences in the Contig:

SY0AAA56YG11FM1 SY0AAC8YJ07FM1 SY0AAD44YN08FM1