Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1604
Length(NT) : 438
Best Gene Model Blast : Link to GSTUMT00006401001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein ATEG_01113
Accession: ref|XP_001208478.1| Score: 363 E_value: 2e-33
KEGG Definition: molecular chaperone (DnaJ superfamily); K03686 molecular chaperone DnaJ
Accession: aor:AO090026000471 Score: 358 E_value: 3e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0712 Score: 163 E_value: 1e-12
PFAM Definition: DnaJ_C, DnaJ C terminal region. This family consists of the C terminal region form the DnaJ protein. Although the function of this region is unknown, it is always found associated with pfam00226 and pfam00684. DnaJ is a chaperone associated with the Hsp70 heat-shock system involved in protein folding and renaturation after stress..
Pfam Number: pfam01556 Score: 231 E_value: 1e-20
Swissprot: P87239|MDJ1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1604
TTGGGGCTCGGAGTGCGGGACCTGCGATGGATGGGGCGTGACGAAGGAGC
CCCGAACAATCACGATCGACATACCCGCTGGCGTAGACACTGGTATGAGA
ATAAAGGTGGACAATGAGGGCGATGCCCCGCATTCGAAAGCCTCCGGCGC
TTCGTCCACCAAGACTTGGAGGGGGGACTTGTTCGTTCATCTTCGGGTTG
CACCGCACAAGTACTTTAGGCGGAAGGGTTTGGACGTCTACTACACTGCT
ACAATACCATTGACTACCGCCCTTTTGGGAGGTCGGATCAGGGTCCCGAC
GCTAAGCGGCGGCGAAGAGGACATTGAAGTCCCCCTAGGCACAACTACCG
GGGACACGACAAAGATCTACAGAAAAGGTATGCGAGGGTTCGACTCCGTA
AGCGTCGGAAATTTTACGGTTGAATTCAAGGTCAACCC

Sequences in the Contig:

SY0AAA56YE13FM1 SY0AAA61YA15FM1