Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1603
Length(NT) : 756
Best Gene Model Blast : Link to GSTUMT00006801001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_09854
Accession: ref|XP_001589221.1| Score: 1041 E_value: 1e-111
KEGG Definition: hypothetical protein
Accession: fgr:FG00371.1 Score: 970 E_value: 1e-103
KOG Definition: No Hit Found
PFAM Definition: CorA, CorA-like Mg2+ transporter protein. The CorA transport system is the primary Mg2+ influx system of Salmonella typhimurium and Escherichia coli. CorA is virtually ubiquitous in the Bacteria and Archaea. There are also eukaryotic relatives of this protein. The family includes the MRS2 protein from yeast that is thought to be an RNA splicing protein. However its membership of this family suggests that its effect on splicing is due to altered magnesium levels in the cell..
Pfam Number: pfam01544 Score: 290 E_value: 5e-27
Swissprot: P35724|MNR2_YEAST

Sequence:
>Contig1603
TTGGGAGCCCGTAAACATCTACTTTGTCGTCTTCCGGGAAGGGGTAATAA
GTTTCCACTTCTCACTCACCCCTCATCCAGCAAACGTCCGGAGACGCATT
CGGCAATTGAAGGATTATATCACCGTGTCAGCGGACTGGATCTCGTATGC
GCTTATCGACGATATCACCGACGCCTTCGCTCCATTAATTCAATCTTTGG
AAGAAGAAGTTGACGAGATTGATGATGCTATCCTGCAAATGCACCTCAGA
TCTGGTTCGGATGGCACTTCGGATAAGAAGAGCAACGTGGGCAGTAGTGC
CTCGGACGGAGCGGAACAGAAGAGCGACGGAGATATGTTGAAGCGGGTCG
GCGATACACGCAAGAAGGTTATGGGACTGTATAGACTTTTAGGAAACAAA
GCGGATGTGATTAAGGGTTTTGCGAAGAGGTGTAATGAGCAGTGGGAAGT
AGCGCCTAGGAGTGAGATTGGGCTGTATTTGGGCGATATTCAAGATCACA
TTGTAACGATGGTTGGTAACTTGAACCACATGGAGAAAATCCTATCAAGG
TCACATTCGAACTACCTTGCACAGATTAACATCAAGATGAACGAACGCCA
GGAACAAACGGCGGACGTCCTCGGCCGCCTTACAGTCCTGGGAACCATCG
TCCTGCCAATGAACATCATAACCGGCCTCTGGGGCATGAACGTGCTGGTC
CCTGGCCAGGAGATCGACAACCTGAATTGGTTCTGGTGCATCACGGCCGG
CCTACT

Sequences in the Contig:

SY0AAA56YE12FM1 SY0AAD25YN18FM1