Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1602
Length(NT) : 820
Best Gene Model Blast : Link to GSTUMT00001828001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An04g03050
Accession: ref|XP_001401672.1| Score: 1135 E_value: 1e-122
KEGG Definition: hypothetical protein
Accession: ang:An04g03050 Score: 1135 E_value: 1e-122
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0217 Score: 826 E_value: 4e-89
PFAM Definition: MutS_V, MutS domain V. This domain is found in proteins of the MutS family (DNA mismatch repair proteins) and is found associated with pfam01624, pfam05188, pfam05192 and pfam05190. The mutS family of proteins is named after the Salmonella typhimurium MutS protein involved in mismatch repair; other members of the family included the eukaryotic MSH 1,2,3, 4,5 and 6 proteins. These have various roles in DNA repair and recombination. Human MSH has been implicated in non-polyposis colorectal carcinoma (HNPCC) and is a mismatch binding protein. The aligned region corresponds with domain V of Thermus aquaticus MutS as characterised in, which contains a Walker A motif, and is structurally similar to the ATPase domain of ABC transporters..
Pfam Number: pfam00488 Score: 577 E_value: 3e-60
Swissprot: Q03834|MSH6_YEAST
Gene Ontology:
GO:0032301 = Cellular component: MutSalpha complex
GO:0005524 = Molecular function: ATP binding
GO:0016887 = Molecular function: ATPase activity
GO:0000400 = Molecular function: four-way junction DNA binding
GO:0005515 = Molecular function: protein binding
GO:0000710 = Biological process: meiotic mismatch repair

Sequence:
>Contig1602
TTGGGAAGTTTGCGAGAAATATTCCCAAAAGCTGGACTCAAATGTCTGGC
ACACAGAAAGTCAAGCGGTTCTACTCCCCGGAAGTCAAAAAGCTTGTTCG
CTCGCTACAGGAAGCACAAGAAACTCATAGCCAAATTGTCAAGGAAGTTG
CTGGGCGATTTTACGAAAGATTTGATAGAGACTATCAGACCTGGCTAGGC
GCGGTGAAGATTGTTGCGAATTTGGATTGTCTTCTTAGCCTTGCTCGGTC
TTCCACCTCGCTTGGTGAAACTAGTTGTAGGCCGACATTCGTTGAGGGTG
AGAGAAGCGTGCTGGATTTTACCGAACTGCGACATCCTTGCATGGTGTCT
AGCGTGGATGATTTTATACCAAATGATATCCAACTTGGTGGAGATTCGCC
TAAGTTAGGTTTACTTACTGGAGCTAATGCGGCCGGAAAGTCAACGGTGC
TTCGGATGACCTGCGTGGGTGTCATTATGGCTCAGATTGGATGCTTCGTC
CCATCGAAGTCAGCTCGGCTGACACCTGTGGATCGCATAATGAGCCGACT
AGGAGCTAACGACAACATCTTTGCTGCACAGAGTACATTTTTTGTTGAAC
TATCAGAGACAAAGAAGATCCTTGCGGAGGCCACACCCCATTCTTTGGTA
ATATTGGATGAGCTAGGCCGTGGGACATCTTCGTACGATGGCGTGGCTGT
GGCACAATCCGTTCTACACCATGTTGCGACCCAAATTGGCTGTCTTGGAT
TCTTCGCAACACACTATCACTCATTGGCTAGTGAATTTATTGGGCATCCG
GAAATTCAACCTAAGAGGAT

Sequences in the Contig:

SY0AAA56YD16FM1 SY0AAB27YO14FM1 SY0AAB48YJ01FM1