Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1601
Length(NT) : 435
Best Gene Model Blast : Link to GSTUMT00010804001 E-value : 1e-77
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_06760
Accession: ref|XP_001797123.1| Score: 135 E_value: 5e-07
KEGG Definition: predicted protein
Accession: aor:AO090120000432 Score: 128 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1601
GAAGTCCGGAGCCGAGTTTGTCGATGCCATGTTTAATGGCGTCAAGGAGT
GGGAGCGCACCGAGAGATTGATGCGGGGTATGGTCATGTGGTGCCAACGT
TTTGAGGTCAACTGCGAGGATATCCTCCGTCGTCCAGATGCTTAGGACGG
ACGACAGTACGAACCAATCCGAAGAAGGGTTTCGGCGGGCGTTCTCTCGA
TTATTCTCTCGTTGGGGACGACCACAATGGAACGCAAAAAGTTTTTTGTT
TTGGCGGGGCGGCTTTGAATTCCTTTTAGATTTCGGCGTTTTTCCATCTC
CCTTTTGATATACCCCCTATTATTCTTGTCGCTTTTACTCTACTCATTTT
TTATTAATTTTTTGCCCTTCTACCTTTTGTCTTTGTATACCCTGTTTTTT
TTTTTTTTTTTTTTTGTTATCGGTTTAATCTTGTT

Sequences in the Contig:

SY0AAA56YD03FM1 SY0AAB19YH24FM1