Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1600
Length(NT) : 352
Best Gene Model Blast : Link to GSTUMT00000889001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001542240.1| Score: 495 E_value: 1e-48
KEGG Definition: SPRY domain-containing proteins
Accession: aor:AO090005001241 Score: 493 E_value: 8e-49
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O74497|YCRA_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1600
CATCTATCTTTTTCGGAACACATCACGGGGAAGGATATGGTTGGATAGGA
TAGGGAGGCCTGGAGAGTATGATGATGAACAGGCTCTGGCAAGGGAGGAG
GCGGAAACTTTGGAACAGATGGACGAGATTTCGAGACAAGAGTACTTGAG
AGCGAAGGCGTTTATCGAAGCAAACCCTCCTGATTCTGTTCCAACCGACA
TATCCCTATCGCAGTTCTTGGCGATTCAAGAGAAAGGTGTTTCGGCGTGG
GAATTTGAGGCCGAGCTAGAGATTGCCAACTGCTTTGTGGAAGCGCGGAC
AGAGATTGAATTTTACGATTCGGTTTGTTCGGTCCAAAGTAACCTCCCCG
TT

Sequences in the Contig:

SY0AAA23YC07FM1 SY0AAA56YC04FM1