Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig160
Length(NT) : 3476
Best Gene Model Blast : Link to GSTUMT00009331001 E-value : 0.0
Numbers of ESTs : 77

Blast Results:

Nr Definition: hypothetical protein CHGG_10343
Accession: ref|XP_001228270.1| Score: 3720 E_value: 0.0
KEGG Definition: PLASMA MEMBRANE ATPASE (PROTON PUMP) [MIPS]
Accession: ncr:NCU01680.1 Score: 3620 E_value: 0.0
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0205 Score: 3047 E_value: 0.0
PFAM Definition: E1-E2_ATPase, E1-E2 ATPase..
Pfam Number: pfam00122 Score: 614 E_value: 8e-64
Swissprot: Q07421|PMA1_AJECA
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane
GO:0008553 = Molecular function: hydrogen-exporting ATPase activity, phosphorylative mechanism

Sequence:
>Contig160
TTGGCCAACTTTTTTGTACAAAGTTGGGCGTGATTCGACCAGCCCCGAAA
GATCCTCAAAATCTTTTCCAGGCAATCGCGGAGACGGTGCGTGTGGGCAA
TTCCTCGGGTGTCTCCTCCACGGCTTCACGCAATTCGGTGTTGTGTGTCG
CTTCCGACGGGTTGATTCTACCAGCATTTGGTGCTCCAATCGAGACGAAA
AAAGAATAGATCGCAATTTATCTCGACCACCTCTCCCCTCAAACCTTTCA
CCCCAATTACCCTCCCTCCCTCACTCTCTCCCCTCTTAACTCTTCGCCCC
TCTCATCTCTCCCTCACCACCACCACCAATACACCCTCCACTGTTATAAG
AACAACACCTTTCTTCCCATCCATCCGTCAGCAATTGATCGAACAAACAA
CCTTTCGTCGCATTGATATTTCACCATGTCGAATACCGTGGCTGAACACA
CGCCTTCGGGCGATCATCACATCCGTACCGACTTTCCCTCTGCTCAATTC
GACTCTGAGAAGCAGCCGATTGATGAGAAGCCTGGAATCGAGGGAATTCC
TCTGGATGATGAGGACGATGAGGATATTGATGGACTTATTCAGGAACTTG
AATCCCTTGATGGCCATGACGAAGAGTTTGAGGAGAGTGACGCCGCTCCC
GGCTCTAGTGCTCGTCCGGTGCCGGAGGACCTCCTCCAGACCGACACCCG
CACTGGTCTTACCTCCGTCGAGGTTGATCAGCGCCGTAAAAAGTATGGTC
TCAATCAGATGAAGGAAGAGAAGGAGAACCTCATTCTCAAGTTTCTCATG
TACTTTGTTGGTCCGATTCAGTTCGTCATGGAGGCGGCTGCCATTCTTGC
TGCCGGTCTCCAGGATTGGGTCGATTTTGGTGTCATTTGTGCTCTTTTGT
TGCTCAACGCTTGCGTTGGTTTCATTCAAGAATTCCAGGCTGGTTCTATT
GTCGATGAATTGAAAAAGACTCTCGCTTTGAAAGCTGTTGTCCTCCGGGA
AGGCCGTCTCTTTGAGATTGAGGCACCGCAAGTCGTGCCCGGCGATATCC
TACAGATCGAAGAGGGAACCATTATTCCCGCTGACGGTCGCATCGTTACG
GAAGACGCTTTCCTCCAGGTCGATCAATCTGCCATCACTGGTGAATCTCT
TGCTGTTGACAAGCACAAGGGCGATCAATGTTATGCTTCTTCTTCTATCA
AGCGTGGTGAGGCCTTTATGGTCGTCACTTCCACCGGTGACAACACTTTC
GTCGGACGCGCCGCCGCTCTGGTTAATGCTGCCTCCGCTGGTACCGGTCA
TTTCACTGAAGTCCTTAACGGTATCGGAACTGTCCTCCTGGTTCTCGTTA
TCTTCACTCTCCTCATTGTCTGGGTTTCCTCCTTCTATCGATCCAATGGC
ATCGTCACCATCTTGGAATTCACTCTTGCTATCACTATCATTGGTGTCCC
CGTCGGTCTTCCAGCCGTCGTTACCACGACCATGGCTGTCGGTGCTGCTT
ATCTCGCCAAGAAGCAGGCTATCGTCCAGAAGTTGAGCGCTATTGAGTCC
TTGGCTGGTGTTGAAATTCTTTGCTCCGACAAGACTGGTACCCTCACCAA
AAACAAACTCTCTCTCGCCGAGCCATATACCGTCGAGGGCGTCGAGGCTG
ACGATCTCATGCTTACCGCCTGCTTGGCCGCTTCCCGCAAGAAGAAGGGT
CTTGATGCTATCGACAAGGCTTTCTTGAAGTCTCTCCGCTTCTACCCTCG
TGCTAAGGGCGTCCTCTCCCACTACAAGGTTCTTGAGTTCCACCCCTTTG
ACCCTGTCTCCAAGAAGGTTACCGCTATTGTCCAGTCTCCCCAAGGTGAA
CGAATTGTCTGTGTCAAGGGTGCGCCTCTCTTCGTTCTCCGCACTGTTGA
GGAAGACCACCCCGTCCCCGAGGACATTGCCAACAACTACAAGAACAAGG
TCGCTGAATTCGCCACTCGTGGTTTCCGTTCTCTCGGTGTTGCTCGCAAG
CGTGGTGAAGGCCATTGGGAAATTCTCGGTATTATGCCTTGCTCTGATCC
TCCTCGTCACGATACCGCCAAGACCATTAATGAGGCCAAGACTCTCGGTT
TGTCCATCAAGATGTTGACTGGTGATGCTGTTGGTATTGCTCGTGAAACT
TCCCGCCAGCTCGGTCTTGGTACCAACGTCTACAATGCCGAAAGGCTTGG
TCTTAGCGGTGGCGGTGATATGCCTGGTTCTGAGGTCTATGATTTCGTTG
AGGCAGCCGATGGTTTCGCCGAGGTTTTCCCTCAACACAAGTACAATGTC
GTCGAGATTCTCCAGCAACGTGGATACTTGGTTGCCATGACTGGTGACGG
TGTTAACGATGCTCCCTCCCTTAAGAAGGCCGATACTGGTATTGCTGTCG
AGGGTGCTTCCGATGCTGCCCGTTCCGCTGCGGATATTGTTTTCTTGGCT
CCTGGTCTCTCTGCCATCATTGATGCTCTCAAGACTTCCCGCCAGATTTT
CCACCGAATGTATGCCTACGTTGTCTACCGCATTGCCTTGTCACTCCACT
TGGAGATATTTTTGGGTCTCTGGATTGCCATTTTGAACGAGTCCCTCAAC
TTGAACCTTGTTGTCTTTATCGCCATCTTTGCCGATATTGCTACCTTGGC
CATCGCCTACGACAATGCGCCCTTCTCCAAGTCTCCTGTCAAGTGGAACC
TGCCCAAGCTCTGGGGCATGTCTATCCTTCTCGGTCTTGTCCTTGCTATT
GGTACCTGGATTGCACTTACCACTATGTTCGCCGGCGGAAGTGATGATCG
CGGTATCGTTCAGAACTTTGGTAATCGTGATGAGGTCTTGTTCTTGGAGA
TTTCCCTCACTGAGAACTGGCTTATCTTCATTACTCGCGCCAACGGTCCT
TTTTGGTCCTCTATTCCTTCTTGGCAATTGTCTGGTGCCATCTTGCTCGT
TGATATCATTGCTACTCTCTTCACCATCTTCGGTTGGTTTGAGAACAGCG
AACAGACCAGCATCGTCGCCGTCGTCCGTATTTGGATCTATTCTTTTGGT
ATTTTCTGTGTCTTGGGCGGTGTTTACTATCTCCTCCAAGACTCTGTTGC
ATTTGATAACTTCATGCATGGAAAGACCCCGAAGAAGGACTCGAAGAAGC
GGTCCTTGGAGGACTTTGTTGTCTCGTTGCAGCGTGTCTCAACCCAACAC
GAGAAGTCATCATAATAGAAGGCGTGTTGGTGCTATGCTTTTCATTTGGT
GTTGATTTTTTTTTTTTGTATACACTAAAGGGGCACTGCCTTGTTGCTGA
ACAATTGACGGTTCTCCTTGTAGAGTTTAAAAGAAAAGTGTGGAAGGGAA
TTTTTTTTTTGTCTAATGTGTATGAAGAAACGGGACTGTCAATAGCTGTA
TTATGCATTGTAGAAATTGGGTTTCATGTTTTCCTTTAGCTACTTGAATT
AAGCTCTGGTGTTCTATACGAAGAAG

Sequences in the Contig:

SY0AAA10YC15FM1 SY0AAA10YN15FM1 SY0AAA15YD17FM1
SY0AAA15YN19FM1 SY0AAA19YD11RM1 SY0AAA19YI01FM1
SY0AAA19YK21FM1 SY0AAA1YE18FM1 SY0AAA1YJ17FM1
SY0AAA22YI02FM1 SY0AAA23YA08FM1 SY0AAA23YO15FM1
SY0AAA26YP07FM1 SY0AAA2YD14FM1 SY0AAA2YG18FM1
SY0AAA2YI05FM1 SY0AAA34YK06FM1 SY0AAA35YF10FM1
SY0AAA36YG03FM1 SY0AAA38YE10FM1 SY0AAA39YP13FM1
SY0AAA41YG22FM1 SY0AAA41YO06FM1 SY0AAA42YC11FM1
SY0AAA43YI12FM1 SY0AAA45YH05FM1 SY0AAA45YL11FM1
SY0AAA49YE05FM1 SY0AAA49YG02FM1 SY0AAA4YI04FM1
SY0AAA52YE19FM1 SY0AAA53YI24FM1 SY0AAA53YL14FM1
SY0AAA54YJ24FM1 SY0AAA57YB08FM1 SY0AAA61YH14FM1
SY0AAA8YB22FM1 SY0AAA9YE04FM1 SY0AAB13YD08FM1
SY0AAB16YL23FM1 SY0AAB17YI13FM1 SY0AAB19YB22FM1
SY0AAB19YP15FM1 SY0AAB1YJ12FM1 SY0AAB20YI18FM1
SY0AAB22YP19FM1 SY0AAB24YM20FM1 SY0AAB25YC04FM1
SY0AAB26YO17FM1 SY0AAB2YA04FM1 SY0AAB32YG17FM1
SY0AAB34YH10FM1 SY0AAB34YL19FM1 SY0AAB35YF18FM1
SY0AAB36YF03FM1 SY0AAB36YL18FM1 SY0AAB39YP24FM1
SY0AAB42YM24FM1 SY0AAB45YG15FM1 SY0AAB48YO21FM1
SY0AAB49YP09FM1 SY0AAB50YK05FM1 SY0AAB51YM12FM1
SY0AAB54YE20FM1 SY0AAB56YA03FM1 SY0AAB57YE03FM1
SY0AAB57YO05FM1 SY0AAB59YB10FM1 SY0AAB60YM02FM1
SY0AAB60YM24FM1 SY0AAB61YH01FM1 SY0AAB9YE22FM1
SY0AAC31YD17FM1 SY0AAC3YM12FM1 SY0AAD16YC10FM1
SY0AAD61YL09FM1 SY0AAD62YB22FM1