Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig16
Length(NT) : 2316
Best Gene Model Blast : Link to GSTUMT00012003001 E-value : 0.0
Numbers of ESTs : 58

Blast Results:

Nr Definition: peptidyl-prolyl cis-trans isomerase
Accession: ref|XP_001593561.1| Score: 1127 E_value: 1e-121
KEGG Definition: hypothetical protein ( (AJ292563) peptidyl-prolyl cis-trans isomerase [Neurospora crassa OR74A] )
Accession: ncr:NCU03853.1 Score: 1115 E_value: 1e-120
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0546 Score: 1080 E_value: 1e-118
PFAM Definition: Pro_isomerase, Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD. The peptidyl-prolyl cis-trans isomerases, also known as cyclophilins, share this domain of about 109 amino acids. Cyclophilins have been found in all organisms studied so far and catalyse peptidyl-prolyl isomerisation during which the peptide bond preceding proline (the peptidyl-prolyl bond) is stabilised in the cis conformation. Mammalian cyclophilin A (CypA) is a major cellular target for the immunosuppressive drug cyclosporin A (CsA). Other roles for cyclophilins may include chaperone and cell signalling function..
Pfam Number: pfam00160 Score: 682 E_value: 6e-72
Swissprot: Q9P3X9|PPID_NEUCR

Sequence:
>Contig16
TTGGCTCGGGAGAGTAGAGAGCTCTCTCCTTCCTCACCCCCCCCCACTCT
ACTTTACTCTTTTGCCCCTTCCTCCCTCCCCCCTTTACCTTTAAATAGGG
AGGGACGCACGTCGCCAATGTGAAAAGTAGTCCAAAGGTTTTCTGAAAGC
TCTTCCTTCCTCATCTATCCATACCAAAAGTGACTACCTGTCCTTGATAC
GTTATCCTCACCTACATTACCGCATATTTTCCCCCCTTTTCCTTCCCTCT
CTGGCCGAAAAGCAGAAAGAAAATCATTCGGTTGAAATCAGTTGAAATAA
AGGCATACGAGGTATCATAACTCAGCATAGAAGGAGGAAGCAAGCAAACG
AGACCCTATCTTTATTACACGACGAGAAATAGGGTCGATCGCGAAGAAAT
AACGAGAAGAAAAAAAGGGTATTTGGGAAACCATGCAAGTTTCTTCGCTC
GTGCAGCCACAGGATTGGAATGTTCTTGAGCAATTGAGATCACGCAGAGG
GGGCAGTGGGACACAAGTTGGGAGTGGGAGTGGGAATGTTGGTGGGGAAA
AGCATGCCGGGGCTAGGATTATTCCGTACAGTTCAGATCTGTTAGGCGGA
GGAGGAGGAGTGGTGCTGGGAGGAGGAGGGGGTTCTGGAACCTTCCGCGT
ATCTTCAAAAAGGGCTCGAAACGCTTCCTCAACACCAGCACCAACACCAG
TTCTATTCCCATCTCCATATCCTCACCTTCCACCACTGGACCCGAAAATC
TTTCCAATTGATCAACCACCTGTTAACAAACGGCAACGAACTATGTCTGA
AGAAACTGCTTCGCCCGCTTCTACCACCCCCTCCAGTACTCCTAACCGCC
CTCGAGTTTACCTCGACATTTCGATAGCGGGGAAACGACCTGAACGTGTT
GCTTTCGAGCTGTATAATGATATTGTACCCAAGACCGCTGAGAATTTCCG
TGCGCTTTGTACCGGTGAGAAGGGTATTGGAAAAAGTGGAAAGCCGTTGC
ACTACAAAGGCTCCACCTTCCACCGTGTTATTAAGAGGTTTATGATTCAA
GGTGGTGATTTCACTGCTGGTAATGGGTCTGGCGGTGAATCGATCTACGG
CACCAAGTTTGGGGACGAGAACTTCGAGAAGAAGCATGACAGGCCATTCT
TGCTTTCCATGGCAAATGCTGGTCCTGGCACCAACGGAAGTCAGTTCTTC
ATCACCACTGTCCCGACTCCCCATCTCGACGGAAAGCATGTAGTCTTCGG
CGAAGTCCTATCGGGGAAGAGCACAATCAGGAAGATTGAGGATCTTAAGA
TTGATAATACCGATAAGCCCGGAAAGCCCGTTGTAATTGAAGACTGTGGT
GAACTGAATGGCCCTGATGCCGAGGCGGCTGGCCTACGCAAGAACGATGG
AACAGGTGACCCCTACGAAGATTTCCCTGATGACGAGAACCCCGAAATGG
ACGGTTCTACCGTTTTACGAATTGCGACCGAACTCAAGGAATTTGGCAAT
AAAGCATTCAAGGCTGGTGACACCGAGCTTGGTTTGGATAAATACGAGAA
AGGCCTACGCTACCTGGCAGAATACCCGGCGCTTGTTGAGGGTGACCCAC
CCCAGGTGTTTCAAAGTATCAAGGCGTTGAAGTTCATTTTGTACTCCAAC
ATTGCGCTTCTGCACAACAAGCAGAAGGGATATAGGGAAGCGGAGGATGC
CGCAACCAAAGCTCTTGCCATCGAAGAGGTGGCTGGACCCGAGAGAGCGA
AGGCACTGTACAGGAGGGCCACGGCGAAGGTTGCATTGAAGGATGAGGAT
GGTGCGTTAGATGACCTGAAGGAGGCACATAAGCTTGCACCCGACAACGC
GGCCGTGACAAAGGAGCTGGACGCAGCTAAAAAGAAGCTTGCAGCCAGAA
AAGAGAAGGAGAAAGAGGCCTACAAGAAGTTCTTTTCCTAGATGATTCGT
GGAGCTTTTTTCATGTATTTTTCATACTATAACTAGGGGTTTTTTAATTG
TATCGCTTTAGAATGGTCACGCCCGTCAAGCCTACAGATCGGGCATGGGT
GTGGTACATTGGCTATTTCCGTGGCCAAGTTGAGTTTCTTTCTTTCCTTC
CTTTTTTCGTTCTCTCTTTTTTTTTCTTTTTTTTCTTTGCAGGAGTAATC
CCTTGTGAAAGCTTCAGTAGCTGGCATGATAGGTCAGCCTGAAGGTTTTA
GAGATGCAAGAAATGAACCACCCATATCCAATAGGACTGTGGGAACGGGT
ATAAGTTCACATGCGAGAAGTAAGCTCCTGTGCTCGTACTCGAGTATGGT
ACGGCAGACTTACGAG

Sequences in the Contig:

SY0AAA10YH05FM1 SY0AAA22YC23FM1 SY0AAA22YI18FM1
SY0AAA24YG24FM1 SY0AAA24YG24FM2 SY0AAA24YG24RM1
SY0AAA27YB04FM1 SY0AAA47YC05FM1 SY0AAA50YP07FM1
SY0AAA54YO09FM1 SY0AAA55YM11FM1 SY0AAA57YK10FM1
SY0AAA58YC03FM1 SY0AAA60YA12FM1 SY0AAA60YM04FM1
SY0AAB13YB02FM1 SY0AAB13YB18FM1 SY0AAB15YJ04FM1
SY0AAB21YF03FM1 SY0AAB22YG02FM1 SY0AAB26YI11FM1
SY0AAB29YE08FM1 SY0AAB2YG02FM1 SY0AAB2YN02FM1
SY0AAB48YB06FM1 SY0AAB50YM15FM1 SY0AAB52YE08FM1
SY0AAB53YE08FM1 SY0AAB56YN15FM1 SY0AAC22YJ18RM1
SY0AAC24YO04FM1 SY0AAC28YE03FM1 SY0AAC2YL05FM1
SY0AAC34YG06FM1 SY0AAC36YI13FM1 SY0AAC50YJ09FM1
SY0AAC51YN06FM1 SY0AAC53YC03FM1 SY0AAC55YG16FM3
SY0AAC56YF14FM1 SY0AAC58YK20FM1 SY0AAC6YC22FM1
SY0AAC7YD15FM1 SY0AAC8YG22FM1 SY0AAD12YN12FM1
SY0AAD13YP11FM1 SY0AAD15YA15FM1 SY0AAD23YI12FM1
SY0AAD25YE22FM1 SY0AAD32YI24FM1 SY0AAD33YI17FM1
SY0AAD36YM17FM1 SY0AAD36YP21FM1 SY0AAD38YK18FM1
SY0AAD39YC23FM1 SY0AAD57YA09FM1 SY0AAD58YF03FM1
SY0AAD63YF03FM1