Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1599
Length(NT) : 979
Best Gene Model Blast : Link to GSTUMT00011499001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001259259.1| Score: 164 E_value: 1e-09
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G14200 Score: 153 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1599
ATAACGGCCCATGAATGTTAGGCAGCAGCAGCACACATCTAACACCCTAC
TCCACCCAGCCCAGTACGGGGAAAACCTCTTTATTGACTCAGCGACTGCA
CCAGGGTGGAGCAGTAATGAAAATACTCCCCGCCTCTTCAATCCTTAAGG
CCCTTTTAGATACAGAGGGTCGACAAAATACCCACCGCCTCCCAAGGACC
AAAGCATCAGCGAGGGCCAGAGCATCAACAATGTCCAAACCAATACCCCT
CCCATCGCCACCCACCTCCCCACCCCGCCCGCTCTCGGAAAACGCCACAG
CTGCAACAACGACCGCACCACCACTCCCCCTCCGCGAGATGGTAATCTCG
CCCGTGGGTGACATACTCCTCCACCTACTCACACCTACCCACACCCTGCA
CTACAAAACCTCGGCGAGTGTGCTAATCACCACGTCGAAGGTCTTCTCCG
CAATGTTGAGCCCGACATCCCCTTTCTCCGAGGCCCAGCGCTTCAACAAC
TCCCCCCACTCGACGCATCCGTTCGTGCTAAGGCTCCATGACGATGACCC
CGTAGCCCTCTGCATCCTCTTGAAAGCTCTGCACAACCACCCATCCGTTC
CCCGTTCGCTGACCTTCAGGCAGCTGGTCAAGATGGCCGTCGTGGTGGAC
AAGTATGATTGCTCCCACGCCACCAGAATGTACGGCGATAAGTGGATGAA
GGGCTGGACCTCCAAGGCTGAGAAGGCGGGGTACGAGGAGTGGTTGTTCG
TGTCGTGGGTGTGGGGCGTGGAGAAGATTTTCGGAAAGCTTTTCGGGAAG
GTGGTAAAGGAGGTGTGCGTCCAGAGGGTCGGCGGGGGCATGGACAAAAT
TCCCGTTCTCAAGGAGAGGAAAGGTGGGGGCGGGTTCGAGGAGTATGTGC
CTGAGAGTGTGTTGAAAGCGATATTAAACCACCGCTCAAACCTCCTCACT
CACTTGAAGACCGTATTTGCCTCCCTTTT

Sequences in the Contig:

SY0AAA10YM24FM1 SY0AAA56YB03FM1 SY0AAC36YJ24FM1
SY0AAD30YP21FM1 SY0AAD45YK01FM1