Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1598
Length(NT) : 936
Best Gene Model Blast : Link to GSTUMT00005373001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: poly(A) polymerase Pla1
Accession: ref|NP_595362.1| Score: 964 E_value: 1e-102
KEGG Definition: pla1; poly(A) polymerase [EC:2.7.7.19]; K00970 poly(A) polymerase
Accession: spo:SPBC646.04 Score: 964 E_value: 1e-103
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2245 Score: 942 E_value: 1e-102
PFAM Definition: PAP_central, Poly(A) polymerase central domain. The central domain of Poly(A) polymerase shares structural similarity with the allosteric activity domain of ribonucleotide reductase R1, which comprises a four-helix bundle and a three-stranded mixed beta- sheet. Even though the two enzymes bind ATP, the ATP-recognition motifs are different..
Pfam Number: pfam04928 Score: 806 E_value: 1e-86
Swissprot: Q10295|PAP_SCHPO
Gene Ontology:
GO:0005847 = Cellular component: mRNA cleavage and polyadenylation specificity factor complex
GO:0004652 = Molecular function: polynucleotide adenylyltransferase activity
GO:0006378 = Biological process: mRNA polyadenylation

Sequence:
>Contig1598
TTGGGCCAACGTAAACTCGGTTCCGAAGGATATGGCACTCAGTGACAAGG
AGCTGCTAAGAGGGTGTGACGAAGTTAATCTTCGTTGTTTAAATGGCACC
CGGGTTACTGATGAAATATTAACTCTTGTTCCCAAACCTGGTGTCTTTAG
GATGGCATTGAGGGGGATAAAGCTCTGGGCACAACGGCGCGCTATTTATG
CCAACGTTATGGGATTCCCCGGTGGTGTGGCGTGGGCTATGCTTGTTGCT
AGGATCTGCCAACTTTACCCTATGGCCGTTAGCGCAGTTGTCATAAGCAA
GTTCTTCAAGATTTTGGCTCATTGGACTTGGCCTCAACCAGTCCTTTTGA
AAGGTATTGAAGATGGTCCATTGAGTGTTCGGGTCTGGAACCCTAAGATA
TATCCTTCTGATCGTGGACACCTAATGCCCATCATTACCCCAGCGTATCC
AAGTATGTGCGCTACTCACAACATAACCAAATCTACCAAATCAATCATTA
TTCGAGAAATGAAACATGCTGCTGAAATAATGGACGGTATTATGGTCGGC
AACTTGAGCTGGGATAAGCTTTTTGAGCGCCATTCATTCTTTACAAATGG
CTATCGGTACTACTTGAGTGTAGTCGCTGCTGCTAAAGACAAAGATACGT
TACTTGGATGGTCTGGCCTTGTGGAGTCTAAGCTTCGTCACTTAGTCATG
AAGCTCGAGATACTTGAAACCATCAAACTTGCACACCCTTTCAACAAAGG
ATTTGATAACGTTCACTTTTGTGAGACTGAGGAGGAAGCTATCCGCATTG
CTAACGGTGAAATAAAAGCTATTGATAACCAAGTGGGTGTGAAGACAGTA
GTCACAGATCTCAAAGCAGAGCAGAATGGAGATGTTGAGAAGAAAGAAGA
CGAATCCAAGTTTAAAGTTTACACCACAACTTATTA

Sequences in the Contig:

SY0AAA55YN11FM1 SY0AAB33YO12FM1 SY0AAC62YL08FM1