Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1597
Length(NT) : 935
Best Gene Model Blast : Link to GSTUMT00008725001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500181.1| Score: 237 E_value: 4e-18
KEGG Definition: hypothetical protein
Accession: yli:YALI0A17919g Score: 237 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9P7X4|YH6B_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1597
TTGGCTTTTCCCCTTGTCCTTCCTCGCGGGCAGCACCAACACTGTCGGCC
GGGGTCAGTGTCGGTCGTGGTACCGCTCTGGAAATTACCGCTCGATAGCC
AGGAGACGCTCTCGGACTTTTGCCGCCAATTCAGGAGATTCCACAGTTCA
TGCGCCATGGTCCACGGCTTACACCACGGTCATCGCCCTTTCTCTGTCTC
CTGCCTGCCTATATGTACAGGCTTCCCCCCCAGGCGCACTTTTCCTTCTC
CCGTCGTCGTCCTTTGCACCGCCGTCGCTCGTTACGATCTTTAATTTCTA
TACTCGCGATCCTTTTGAAACTATATTATATTTTCCTTAAGGCTTTGGTA
ATTGCCAAGCGGAGGGTTCCTATCATCTATTAGTGACTCTCGGAATTCGA
CCATAATGACCCGCTCTTCTAGTCTCCTCGCAGGGGGCTTCCTTGCCCTC
TCCGTTATGTTTGGCTCCACTGCTGGGGAATCATCGCAATGCAATCCCGG
GCTCGTCATCAACTCGATCTCGTACTGTAACCGCGTTGACAATCTTGGGT
ACAGCAACATGGGATATAGCGGGGAGTACCAGCAGGTCACCGGCATGGAC
AAGCACTCTTGCAAGTGTACCTACACTACGAAGAAATTTTCTGGTCCTGG
GGCACCATTAAATGAACCAATATCTCTTCACTTCCGTGGTCCCATAAACT
TGAAACAGTTTGCCGTATATACTGCAGACAACAAGAAATCCAAGCGCTCA
GAGAAGCATCTGCGTCGTCATGCCCATGGCCACAAGCACAAGCGCGTTGC
TGAGCCCGCTTTAGAGGTTGTCACTGAGTATACTACGGCTTACACAACAG
TCGAGACCGAGGTCACCGTGGCCCCTGTTCCGAATTATGTCAAGAGTGAT
GGTCCATCTCCGGGCAGCTCACACCCCCCTACCGT

Sequences in the Contig:

SY0AAA24YL14FM2 SY0AAA31YD15FM1 SY0AAA55YM13FM1
SY0AAA57YA23FM1