Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1596
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00006760001 E-value : 1e-140
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1596
TTGGCGCAGTACTGATAGGTGAGATATGACATCTTGTTCTTCCCCTCCTC
ACGAGAAAGTCAGTTATAAAGCCCCCCCCTCCCCCCATCATCAACCATCG
CACCGGATCAAACCCTATCATCTGATATCGGGACCTCGAACCATCCTCCC
TTCCTCCCATCCACCTATATAAACATTCGAACAAGAGCAAAGGAAAAAAG
AAAAAGGCCCACAGAATAAAAAAATGTGCCTAATATCCTCCCGCGACGAC
GATTACCCGCCTGCGCGCCGGGTCCACGTTTACCGCGAAGGGAGGGTCAC
CCGCGAATACGCTGCGACTCCTAGGAGGAGTTACTTTTCCACGTCGAGTA
TCGGTGGGGGAAGAAGCAGTACCGCGCGCGTGCGGCATGTGTATTCGTCG
CCGAGGGGGAGTTGGGTTAGCACTCGGGAGGTTCCGGGAGCGGTGGTGTT
GAGTGGGAGGAGGGGCTACTATTAGGTGTGAGGGGTGAGAGTGGTGGCTG
AGAGGATGGGATGGGAGGGAAATAGTGTAGGCTGCTTATTGAGTGGGGAT
TTTTCGTTTAATTTCTTATTGTATTGTCCTTTAATGTGGTTTATTTATTT
TATTCTCCCCCACCCCTGCTTACTATTATTCAGTACCTTTGAGGAATTAT
TGTTATTATACCCTGCGGGGGTTTCCGTTCTTGATCTCGTTTTCTGGTAC
TGTACTTCAG

Sequences in the Contig:

SY0AAA55YL20FM1 SY0AAD22YE20FM1 SY0AAD53YN14FM1