Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1595
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00009228001 E-value : 0.0
Numbers of ESTs : 25

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG4726 Score: 135 E_value: 4e-09
PFAM Definition: No Hit Found

Sequence:
>Contig1595
TTGGGCGGTGCCAAGCAATCAGCAGCCATCAGTCGACCATGAAGATTCAA
TCCATTGCAATTTTTGTCGCTGCCGTCTTCACGGGGTTCGCTTTTGCCTC
TCCGGTCCCCGGGGCAGAACCTGCTCCAGCAGTTGACAGCGTGCCTTGTG
GATGCACTAATGATTGCATTATTGCCTGTGCGGGCAGGCCAAACTGCAAT
TGCCCCCAATTTTGCGACCCGAAATATGCTTGCCCCACGACAACGACCGC
GAAACCGACAACGACAACGTCTCCAACCCCGACTTTCCCGCCGGGAACTA
CGTGTGGATGCCATAACTCTTGCACACTCTTTGGATGCGGACCGGATATT
CCAAGGGATCAATGCGTTTGCCCCCAATTTTGCGACCCCATTTATGAATG
CCCCCCTACGCCCACCACCACTGCCCCACCAAGGCCAACCTTCACGTGCG
GCTGCACGAATGATTGCAAGATTGCTTGCGGTGGAAGGCCAGGGTGTATT
TGCCCTCAGTTCTGTGATCCGAAGTATGAGTGCAAGACGACCACCTGAGC
TGGATGGAATTAGTTCTTTGTGATTTTTATTTTTATTTTTATATTTAGAA
ATGTACGGTGTAAATCTGATCAGTTTACTGGCCGTTAAAATTTGATGCTC
TAATCAAGGCTGAGGTACCTCATAGCCAAGTACTCGTATGATTACATGTT
TAGTATACAG

Sequences in the Contig:

SY0AAA21YE06FM1 SY0AAA36YL10FM1 SY0AAA38YL11FM1
SY0AAA42YG12FM1 SY0AAA47YB05FM1 SY0AAA49YA24FM1
SY0AAA55YJ09FM1 SY0AAA55YL17FM1 SY0AAA61YC09FM1
SY0AAB14YA10FM1 SY0AAB15YO12FM1 SY0AAB22YF04FM1
SY0AAB22YG04FM1 SY0AAB24YP06FM1 SY0AAB2YK06FM1
SY0AAB40YL21FM1 SY0AAB47YN22FM1 SY0AAB48YB21FM1
SY0AAB50YD18FM1 SY0AAB59YD05FM1 SY0AAB8YH04FM1
SY0AAC41YJ14FM1 SY0AAD50YC05FM1 SY0AAD57YH17FM1
SY0AAD59YB01FM1