Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1594
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00011697001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_11068
Accession: ref|XP_001801319.1| Score: 299 E_value: 1e-25
KEGG Definition: hypothetical protein
Accession: ncr:NCU08889.1 Score: 184 E_value: 1e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1594
TTGGACTTGATGGCCCCGTTCTATGGTCGAGTGAGCTATTTTCCCGGGAC
GACCGAGAAATGGCTATTAACCGCCAGAAGGGCGAACTCTACTTGGCAGG
TGTGGGTACCCTAAGTGTGTCAGGAGATGATGATCATGAGGATGGGCGTG
TTAAGCGCGGCCTGGATATGCTTCGAAGGCCAAGTACCAGTGACATTTTC
GGCAGGAACCGGTCTGCAAGCATCGTCAACTCTATCCATGATCTCCCATC
GAGCCGTGGTAAAGGAAGGACAAAATCCAATGCCGGCCTTATGGATTCCA
TTGACAGACAAGATTTGTTTGGCATGCCCAGTCCGGCTTTGCAACCAGAA
ACTCACAATACCTATTGGTCCCCGTTTTCTTCTCACAGCAATAATTCCAG
TTCCGGTAGACCCAAAACTGCACATTCACCAACTTCATTATCCAAATCCT
TGGAGACAGTTAACCATCAAAAAAGGAAATTCCTAGGAGAGTTGAAGCAA
TCACTAACCGGCCTTCTCTTGAGTGACCTTGGTCTGGAGGTCTTCAGCAA
GGGCAGTGAAACAGACGGATGGTTTTCGGGTGGCCTAGGTGATGAGTGTA
TCCAGAGGAAGGAAGAGCA

Sequences in the Contig:

SY0AAA55YK18FM1 SY0AAC20YC22FM1