Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1593
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00005025001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_06601
Accession: ref|XP_001592360.1| Score: 369 E_value: 8e-34
KEGG Definition: hypothetical protein
Accession: ncr:NCU01065.1 Score: 364 E_value: 2e-33
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0682 Score: 388 E_value: 1e-38
PFAM Definition: Ammonium_transp, Ammonium Transporter Family..
Pfam Number: pfam00909 Score: 332 E_value: 4e-32
Swissprot: Q9C0V1|AMT1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005887 = Cellular component: integral to plasma membrane
GO:0015398 = Molecular function: high affinity secondary active ammonium transmembrane transporter activity
GO:0015200 = Molecular function: methylammonium transmembrane transporter activity
GO:0015696 = Biological process: ammonium transport
GO:0001403 = Biological process: invasive growth in response to glucose limitation
GO:0015843 = Biological process: methylammonium transport
GO:0007584 = Biological process: response to nutrient

Sequence:
>Contig1593
TTGGGACATGGCCAAGACAGATAAATTCATATTCGACTATATCAACGAGC
GAAAGCTAAATGTTACTACCGACTCCGACGAAATTGGTCATGATCCGATG
GCTTGGTTTCAGGTTTGCATTCTCTTGGTTTCTTAACAGCAGGCCTAAGT
CAAGTTATCCTAATTAACCAATCTTATATAGGGTGCCGATGTCGTTTGGA
TGTTAATTTGTACTATTCTGGTGATGTTGATGCCGGCCGGAATAGGGTTT
TTTTATTCGGGGATATCAAAGCGGAGGTCTGCTATGTCTATGATCTGGAT
ATCGTTTCTGGCAATGTCGGTGGTAGGAATACAGTGGTATCTTGTAGGCT
ACGGCATAGCTTTTGGACATTCAGACAACCCATTCTGGGGTAGTATTGCG
GGCATTGCTCTGAGGGATGTCCTTACCAGACCAGTCGGGAACCAGAATGG
ACCCCCGATCCCGGAATTACTTTTTGCTCTCTTTCATGGTGCATTTGCCT
CTTTTACCGCTTCATTGATAGGTGGAGCTGTCGTGCAAAAGTTTCGAATA
GTACATTTTTTGGTCTTTATCTTCATCTGGACTACCTTTGTTTATGCACC
TATTGCACATTCGACATGGAGTCCGTCAGGCT

Sequences in the Contig:

SY0AAA55YK16FM1 SY0AAB59YL20FM1