Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1592
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00008517001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_06447
Accession: ref|XP_001796818.1| Score: 501 E_value: 5e-49
KEGG Definition: cellulose-binding GDSL lipase/acylhydrolase, putative
Accession: afm:AFUA_2G00510 Score: 401 E_value: 9e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1592
TTGGGGTTCGTGATGTTTTCAAGGCTCTCTATCATTTCATTGGGTTTGGC
GGACGCATTATGCGGTGCAATCCCGTTTGTGGAGGAGGGATATAACGAAC
ATGTTTATCCTGGATGGGATCAATTGAAGTATCTTTTTGTCTTTGGTGAT
TCCTACACTACTACGGGCTTCAACTTAACCAATGGGTCGCCGCTGCCAAG
TTCTGGAAACCCGATGGGAAACCCGGCGTGGCCGGGGTCGACTTCTGCGA
ATGGCCCAAATTGGGTAGGATACTTGACAACCACATTCAACAGATCCGAA
TTACTAACCTACAATCTTGCCTACGGAGGCGCGACCATAAACTCCACCCT
TGTAAAGCCTTACATCCCAACCGTCCTCTCCTTCGCCGACCAAGTCCAAG
ACCTCTTCCTCCCGAACCTCTCCCCCAAATCCCCCACCTCAATCACCCCC
GCCTGGGAGTCCGAGGACTCCCTCTTCCTGATCTGGCTCGGGGTGAATGA
CATCGAGAACAGCTACCGGAATGTCGACCCCGGCGATCTCCACCCGAGCC
TAATGAATGAGTACTTCCGCATTCTGGAGGAACTATACTGTGTCGGCGCT
AGGAACTTTCTGCTCCTGAATGTGCCGCCGATTGATCGTAGTCCGCTTAC
CACCGGACAAGGGG

Sequences in the Contig:

SY0AAA40YK10FM1 SY0AAA55YK15FM1 SY0AAA61YC06FM1