Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1591
Length(NT) : 714
Best Gene Model Blast : Link to GSTUMT00000073001 E-value : 1e-54
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An07g04240
Accession: ref|XP_001391506.1| Score: 155 E_value: 6e-16
KEGG Definition: hypothetical protein
Accession: ang:An07g04240 Score: 155 E_value: 3e-16
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0395 Score: 126 E_value: 5e-08
PFAM Definition: No Hit Found
Swissprot: P52498|RSR1_CANAL
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1591
TTGGCATAGTCAAACGTTGGTTTGGGCTGAGACGCTGTTGTGGTAGCGAA
CGCTCTGCTCGCTCATGTCTAGCTTAACTTAGTTTTTCTTACCTAAACTT
AACTCGCCTCAGCATCTCACATTGCCCGCACCTACCCACCTGCCTGCTTA
CCAGACCCTCTTCACTTCACCTTCTCGCCCCTTCCTCGTTCACAAACTAT
CGTAACTTCACCATCTTCCCATCACCAGCACTCACTACCTACTTACCGAA
CTCACATCACCACTCTCAACCTACCTCCGACTCACTCGCTCACCCACCCA
CTCACTCACTCACCATCGCCCGAAAACAACAGGGCGGGTTGCTATAACCA
AACCAACCATTATCTATGCAGCACAGGTATGATGACAACTTCAGCCCTAC
CCTACCCCGTTTCCATTTACCCCAACCCTTTTTGCAAGATTGACCCCGGA
TACGAATAGCAGAAGACGAGAGTATCATATTGTGATTCTTGGAGCTGGCG
GTGTTGGGAAGAGCTGTTTGACATGTTTGTTTCCCTTATCCATCTGTCCC
CTTACTATATGCTGTTGAATGGCTGTGGGGGGAGGTGCTAAGGGCGATCA
CGGATAGCGCAATTCGTACACAACGAGTGGATCGAGTATTACGATCCCAC
AATTGAGGATGTTTACAGGAAGGTCATCGATGTTGATGGACGGTCGTGTA
TTCTTGAGATTTTG

Sequences in the Contig:

SY0AAA55YK14FM1 SY0AAB4YA12FM1 SY0AAB56YH12FM1