Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1590
Length(NT) : 2006
Best Gene Model Blast : Link to GSTUMT00011164001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein SS1G_06261
Accession: ref|XP_001593339.1| Score: 448 E_value: 3e-42
KEGG Definition: hypothetical protein
Accession: ncr:NCU02590.1 Score: 387 E_value: 2e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1590
TTGGTCGCACTGCTCCTCTTCGCCTCCTCTTCGAATCGTTTAGAGGAAAA
TATTTGTGCCTAGCGTAGCTCGTGTTTCAAACTCCTACTTTTCACTCACC
CGTAATTGGACCTGAGAAACTTCCCTCCGTTGCTCTACGGTAGTACTTGT
GCGAGCGGTGAGCGTCTCCATCCTTTCCGTCATCGCCCACGCTTCACGGT
CTGCCATTGTGCATCGCCGGTGTCACGTATGCACTAAAAATCTTTAGTCA
AATCGGTGAATCAGGTGATACTGCAAGCCCATACCGGTAAACTACTCCTC
CAGATCCATCCGCCGTACAGTATCTAGGATACTCGAGCGCAGCTTGCTCT
GCGTGCTCTTGATAGCGAGCGAGCCGCTGTTGTCATTTCTGTTTTTTTAT
TTTATTTTGGGGGGAGAAAAGTCTACCGACCCGACCGTAACCGTGCCCAT
CTTACTGGTTCTTTCTATTTTTTTCTTTTTTCCTCCCTCTTTGCTTGTTG
TGGGGGGGGGTGTGAGATTTTAGATAACTGGATTGGGTGCTCCGGGATAC
GGAGAGAGATTCTAGGAGCTACATACCACGAGTCAAATCTCAGGGTTTTT
GAGAAACGAAGCCTCAATAAACTATGGCGAACCAGCGCGAGAAGAAGCTA
AAGCGGGAGCGGGGCTACACGCCTCCACTGTCGCCATCTCTGCACTCCAG
TGGACGCGAGGACACCAGTGACCGCAGGCGGACATCCACATCGCCGCCCC
CCATTCCCCGGCATCCCGTACTGAGCATGCAAACCGCCTTTGAGGAATCG
ATTCGTGATGTCCGTGTCGGAACGCAGGGAGAGGAAGCTGGGGGTTCATC
GCCGAGAAGCAGGAAACGTCAGCAAAGGAATAAGGAGTGCGAGCATCATC
GGTTATCGAAGGTTGTTTCACAAATCGCTTTTGGTATTCATCTTTTACAT
GGCCGCCTAGCGAAATCCGACTCGGAAGTCGTAAGGATTTTGCAATCCCA
TGTGAACGATATGGATGGATTCATCTCGAAAACTACAAGGGATTTTGACC
TAGCGAAATCGGATATATCGCAACGGTTGAAACATCTTAGGGTTCCATTA
GATTCGGAAGCTGCGTCGATGGCATTCGACAATATGCTTGAAAGTCGGGA
GTTTAGGTTGCAGATATTGGAGGGCAATGAGAATGTGGAGTATGTGGTTG
AGCGCACAATGGCTGCTATGGGGAAGGCATTGAAGGATGTGGCTGAGGGG
CTAGCTGCGGTGGATGATTTGGCTAAATATCTGCTGGGGCTGGAGGAGGG
GTGGAAGGGTTCGAATTTGGTTAGGGTTTATGCCGCCATGACCTTCAATG
TTGAGCAGTGGTTCAGAGGTCTCGTGGCATTGCAGACGAAATCGGTAGGC
TTGAAGGAGGAGTTAGTGCAGCTGAAGGGTGTACTGGGGGAGATTGAAAG
GAGGACTGGGATTGCAAGCAGGAAGAATAAGGGATCTCTAGCTGTGGTCT
CTCAAGTTACAAAAAAAAAGTCTTCGTCTCGATTAAACAAGTCTCTCCCG
CCCACGCCTGCCCCTGACACATTGTTGAATGCCATCGATGTTCGCATTAG
CAACTCGCACAAAGATTCAAAACGCCTCACCCGCTCAACCTCCCAGACCC
TCGGGCCCACTCGATCTCATTCACAGCGCCTCCCCCACCGCCACTCATTC
CTCTCGACATCCCTCTCAACGACAGACACTAGCACTGGAGCTCCATTTTC
CGCAGGAGAATACGAGTCCGAGAAGGAGGAGGACAAACGGAAGAGCAGCA
GAGTCAGGGTGAGACCCGTTCCGGAGCTATGGCCCGAACCATTATCCCAG
CGCAGCGGGCCCGGGGATGAGCAGGATGATGGCCAAGGAGACAGCGACGA
CTTCGTCTTCCGGCCAGATAACGAAGAGAAAAAAGACAAGGATTTCGCCT
TTAGACCTAGTAAAGATGAGCGGAAGGAAAAGTTAGGGAAGAAGGAGAAG
CGCGAT

Sequences in the Contig:

SY0AAA16YC03FM1 SY0AAA34YD18FM1 SY0AAA55YK12FM1
SY0AAB21YD03FM1 SY0AAB37YG16FM1 SY0AAB41YF02FM1
SY0AAB46YL08FM1 SY0AAB54YC21FM1 SY0AAB55YC21FM1
SY0AAC3YL16FM1 SY0AAC47YM06FM1 SY0AAD38YO04FM1
SY0AAD3YD16FM1 SY0AAD7YB11FM1