Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig159
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00006965001 E-value : 1e-118
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 247 E_value: 1e-19
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 247 E_value: 6e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig159
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCAATATCCTGAACAGC
CAACAAACAGAAAATGCCTCAATCATACAACAATAATACCAACTCCTGGA
ACACGACCGTTAACGTGTCGAACACGGCTATCACGAATAACCTAGTTGTT
GCCGATGACCGACCTGATATCTTATCCTGGTTATCCCCGCTAGATCCCAA
GTTGCGACACCAGGATATCCAAGCTCGCCGTGTGGAAAATATAGGGGAAT
GGCTCTTTCAGACTGAGGAGTTTAGAAGCTGGTACGCCGGTAGCGAGGGA
GGCGGATCCGATAACGCAGTTTTGTTTTGCTATGGAGATCCGGGCGTGGG
CAAGACATATATCAGCTCATTGGTGATAGACAGGTTATGTGATCATGCTG
AAGCGCAAAATACCGCCGTTGCGTGTTTTTACTTCGACTTCGCCGCTCAA
AAGGAGCAGTCACTTACGGGCATGCTGGGCGCCCTACTAAAACAATTGGT
TTGCGGACTAGAGGTGACCCCGGAGGAGGTATCGCGAGCATACCAAGCCC
AAAAGAAATCCATTGGTGGGCGGGGATCACAACTCTCGGATATTGTGAAG
ATGATGCAGAGTACCGCTTCCAAAAAGCGCACATTCATATGCATCGACGC
CCTAGAT

Sequences in the Contig:

SY0AAA15YN18FM1 SY0AAC24YH24FM1