Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1589
Length(NT) : 989
Best Gene Model Blast : Link to GSTUMT00005330001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: isoleucyl-tRNA synthetase
Accession: ref|XP_956014.1| Score: 1457 E_value: 1e-159
KEGG Definition: hypothetical protein
Accession: ncr:NCU03575.1 Score: 1457 E_value: 1e-160
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0434 Score: 1446 E_value: 1e-161
PFAM Definition: tRNA-synt_1, tRNA synthetases class I (I, L, M and V). Other tRNA synthetase sub-families are too dissimilar to be included..
Pfam Number: pfam00133 Score: 631 E_value: 2e-66
Swissprot: O13651|SYIC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006428 = Biological process: isoleucyl-tRNA aminoacylation

Sequence:
>Contig1589
TTGGCTCTCGTAACCGTTACTGGGGCACACCCATTCCTATCTGGATGTCT
GATGACAAAGAAGAGATGGTGTGTATCGGAAGTGTCGAAGAATTGAGGGA
ACTCAGTGGCTGTGGGGAAATCCCGGATCTTCACAGGGATAAGATTGATC
ACATTACCATTCCCAGTAAGAAAGGGAAAGGTGTTCTGCGAAGAGTTGAG
GAGGTTTTTGATTGTTGGTTTGAGTCAGGAAGCATGCCATATGCCAGTAG
CCACTACCCGTTTGAGAACAAAGATCAGTTTGAAAAGGCTTTTCCAGCAG
ACTTCATTGCGGAGGGGTTGGATCAAACACGTGGCTGGTTTTATACTCTC
CTTGTTCTCGGTACCCATCTCTTTGGCGTATCGCCGTTCCAGAATTGTAT
AGTCAATGGTATCGTGTTGGCTGAAGATGGCAAGAAGATGTCCAAACGTC
TCAAGAATTACCCAGACCCGACACTGGTTATGGATAAGTATGGGTCAGAC
GCCCTCCGACTTTACCTTATCAATTCGCCTGTCGTCAGGGCTATGCCACT
GAGATTTAAGGAAGTTGGTGTTAAAGACGTTGTTACCAAAGTCTTATTGC
CACTATGGAATAGTTATAACTTCTTTGAGCAGCAGTCCCAGCTTCTGAAG
AAGCTCGAAGGTGTTGACTTCATATTCAATCCCGAGTCAGGTGGGAGCAA
GAACGTTATGGATAGGTGGATTCTAGCCAATTGCCAGAGCTATCTCAAAT
TCGTGAACCAAGAGATGAAGGGTTACCGACTTTACACTGTTGTTGGGAGA
ATGCTTGAGATGGTCGATAATACTACAAATTGGTATATCCGGTTCAACAG
GAAGCGTCTCAAGGGCGAGTACGGAACAGAGGACACTTTGCATGCCTTGA
ATTCCCTCTTTGAGGTTCTTTTCACTCTTGTCCGCGGAATGGCTCCATTT
GCACCGTTCCTCACAGACAACATCTACCACCGTCTCAAG

Sequences in the Contig:

SY0AAA26YK06FM1 SY0AAA55YK05FM1 SY0AAC13YK02FM1
SY0AAC14YK02FM1