Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1588
Length(NT) : 1455
Best Gene Model Blast : Link to GSTUMT00011500001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001214220.1| Score: 536 E_value: 1e-52
KEGG Definition: synaptobrevin-like protein Sybl1, putative; K08515 vesicle-associated membrane protein 7
Accession: afm:AFUA_6G11270 Score: 531 E_value: 3e-52
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0859 Score: 460 E_value: 2e-46
PFAM Definition: Synaptobrevin, Synaptobrevin..
Pfam Number: pfam00957 Score: 244 E_value: 2e-21
Swissprot: Q9FMR5|VA714_ARATH

Sequence:
>Contig1588
TTGGCGCAAACCCCCACCCACCACCACTATTGACTAGCCAACCAACTCAC
CTACCAACTATTTAACCCGTGATCGAACAGTGAGCACCACGCATCACGGC
CCATCATCTCAATAAAAGACCTGCTGGAAAAAGCAAAACAAGATTCATCG
ACATCTTCCCTCAACCCAATGTCGTCTTCATCTTCTTCCACGCCGCTTCT
CTACGCATGCGTCGCCCATGGCACCACCATCCTCTCTGAATATTCCCCTA
GCGGAGCCGCATCCACAAACGCCTCATCTCTCGCCTCGCTCATCCTCCCC
AAAATCACGCACACGAGCCCGCAGAAGCTCACCTACACCCACGGTCAGCA
TAATATCCACTACATCGCGACCGCCTCCTCGCAATCCACCCCGTTCGGTC
AGACTTTTCTGGTCATCTCCGCAGCCCATATAGGGCGCAAACTACCTTTC
GGCTACCTCCTCGAGATACAGCGCCTCTTCACGAGCAAGTACCCCGCCAG
TGCCGTCGCCGACGCCCCGCCCTACGGATGTGCCGAGTTCAATTCCACGC
TCGGCGCCACCATGCGCCAGTTCGAGGCCGGCGGCGAGAACGAGGACGTC
GTGGCCAAGGCTCAGAGGGAAATTGAGAGCGCACGTGGTATTATGACGGA
GAATATCGAGAGGGTGCTGGAGAGGGGGGAGCGGATCGATTTACTTGTCG
ACAAGACTGCTGGATTGCAGAGTGGGGCCATGGAATTTAGGGTTCGGAGT
CGTGGGCTCAGGAGGAGGATGTGGTGGAAGAATACTAAGTTGATGATATT
GCTAGTATTCGTAGTCATCTTCTTGGTTTACTTGTTCGTCGGGATGGGCT
GTGGGCTTCCTGGCTGGTCTCGCTGTGTTGGCTAAACCATCGGCGAATCC
CACAACTATGGACGTCGGTACGGTCGATCACACTTTTACCGTGGCTTTTA
TTTCAAATTCCTTTCCGTACTAGGGATCTTTGGATTTCTCCTCGCTTTTC
CTATTTCTCTTTTTTTACGCTTCTTGTTCTCTTGGGTTCCTCGGGGCATT
TTATTCTTAACGAAACCCGTGTGTTACTACTAAACTACTGCACTCGACTG
TACTGAGATCAGCCACCAGATGTCAGCTGACAGACAAGTCTTGGGCTTTC
CTCTTATTTTTCTCTTTTTTTTTCTCTCTCTTTTTCCTTCCGCTTTTCTT
TTGTTCGCTAAACTCATCTCTCACTTTTCGGCTTTATTTTTTATCCATTT
ATTTGTTGATCGGACAAATAACAAGGGTTTCATTTCTTGTCTCGATCCCT
TGGCATGAAAACGCTTTTGATTCCGTACCGTGTTATATTTGTGTTGTGTT
CCGTCATAGGCTATGTAAACTTACCGTTTGAGAGCTATTTCTTTTGTGAA
CCGAGATAAATGACCAGCCCAACCTCCTAGCTGGAATAAAAGAAGTCTCT
TAAGT

Sequences in the Contig:

SY0AAA30YM17FM1 SY0AAA37YN03FM1 SY0AAA38YA13FM1
SY0AAA55YK02FM1 SY0AAB14YM11FM1 SY0AAC21YJ17FM1
SY0AAC27YB13FM1 SY0AAC28YN22FM1 SY0AAC28YN22RM1
SY0AAC42YG10FM1 SY0AAC57YI02FM1 SY0AAD22YC14FM1
SY0AAD26YD18FM1 SY0AAD2YH19FM1 SY0AAD51YF12FM1