Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1587
Length(NT) : 888
Best Gene Model Blast : Link to GSTUMT00004488001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_08076
Accession: ref|XP_001798403.1| Score: 1019 E_value: 1e-109
KEGG Definition: ribosome associated DnaJ chaperone Zuotin, putative; K09522 DnaJ homolog, subfamily C, member 2
Accession: afm:AFUA_4G03650 Score: 1001 E_value: 1e-107
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0724 Score: 329 E_value: 2e-31
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 199 E_value: 2e-16
Swissprot: Q9Y7I8|YOI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1587
CATTTCTCTCTGTCTTCATCTATCCAACAACCCCCTCGGCTCCTCCTTTT
TATCACAACCAAAATGGCCTCTGTGAAAATCCCGAAACCGCTCCCCACTC
TTCCAGAAGATTGGAACTCTGAAAGCAACTTTATTGTCCACGCACCACTC
TCTCCTGCAGTTCACCGAAATCTCTCACCAGCGGGGCCCCACTTCCTTGC
CCACGCCCGCAGAAAGCGTCATTCTCGCACTTTTAGTGAAGATGACCGAA
TCCAAGCTCAGCAGAATGTGAAGAACGTTGAGGATGAGGACGCTGGAGAG
ATCAGTGAGGCTGAAAGCCCTGTGTTGCTTTCTCGTGATCCCAAGGATTG
GAAGAACCAAGATCACTACGCCGTTCTCGGTCTCTCTAAATACCGCTACA
AGGCTACCGAAGAGCAAATCAAAAAGGCTCACCGTAAGAAGGTTCTCAAG
CACCACCCCGATAAGAAAGCCGCCGTTGGAGCTGTCGATGATGATTCTTT
CTTCAAATGCATACAAAAAGCCATGGAAATTCTCTCGGACCCTGTCAAGC
GCCGCCAATTCGACTCTGTTGACGAAGGAGCCAACCGTGATCCACCCAGT
AAGAAGTCTAAGGGTAATTTCTACAAGGGATGGGGACCAGTCTTTGAGTC
CGAAGGTCGTTTCTCTCGCAAGCAGCCGGTGCCCAAACTTGGGGATGACA
AATCCATCAAGGCTGAAGTCGAGGAGTTCTACAATTTCTGGTACAATTTC
GATTCCTGGCGTACGTTTGAATATCTCGACGAGGAGGTCCCGGATGACAA
TGAGAACCGTGATCAGAAGCGTTACATCCAACGCAAGAACAATGCCTCCC
GCGCAAAGAGAAAGACGGAGGACACTGCTCGACTACGC

Sequences in the Contig:

SY0AAA24YP15FM1 SY0AAA24YP15FM2 SY0AAA42YD19FM1
SY0AAA55YJ24FM1 SY0AAB61YM18FM1 SY0AAC51YH03FM1
SY0AAD27YL14FM1 SY0AAD34YF11FM1 SY0AAD58YO18FM1