Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1586
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00009302001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_07620
Accession: ref|XP_001797954.1| Score: 496 E_value: 1e-48
KEGG Definition: hypothetical protein
Accession: ani:AN2462.2 Score: 458 E_value: 2e-44
KOG Definition: No Hit Found
PFAM Definition: Polysacc_deac_1, Polysaccharide deacetylase. This domain is found in polysaccharide deacetylase. This family of polysaccharide deacetylases includes NodB (nodulation protein B from Rhizobium) which is a chitooligosaccharide deacetylase. It also includes chitin deacetylase from yeast, and endoxylanases which hydrolyses glucosidic bonds in xylan..
Pfam Number: pfam01522 Score: 318 E_value: 2e-30
Swissprot: P83513|XY11A_PSEXY
Gene Ontology:
GO:0005576 = Cellular component: extracellular region
GO:0016798 = Molecular function: hydrolase activity, acting on glycosyl bonds
GO:0045493 = Biological process: xylan catabolic process

Sequence:
>Contig1586
TTGGGTTAGATCGAGTCCACTACTCTTGCGTCTTTCAATCTCCGTTTATC
CATCTTTCTAAAGCTTCCCCTCGTTGGAGAGAGAAGAAATATACACGCTC
GCTATGCATTTCCAAAAGGTTTCCGTTGCGTCGGCGTTGCTGGCGTTGCT
CCCAGCGACAATTGCTTCTCCATATGGTCTCTTTAATAGGCAGGGACGAA
GCAAGCTGGGGAGTATTCCTTATGGGGCGGACATTTACCGCTGCACTGTG
CCCGGGACAGTTGCCGTGACCTATGATGATGGCCCGTATATATATACCAA
TGAGGTGTTGGATTTGCTCAAGGAGTTCGATGTCAAGGCTACGTTTTTCG
TTACCGGAAACAACATTGGCAAAGGTGCCATCGACAGCGCATCCCAGCCA
TGGGCCGGTGTGATCCGGCGCATGGAGAGCGAAGGCCACCAGATTGCCTC
TCATACTTGGACCCACCAAGACCTCTCGAAAATCAGTGAAGCCGAGCGGA
GGGACGAGATGCTCAAGAATGAGGCGGCGATCAAGAACATCATCGGAAAG
TACCCAACATACATGCGCCCTCCGTACTCCTCCTGCA

Sequences in the Contig:

SY0AAA55YJ21FM1 SY0AAC6YP16FM1