Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1585
Length(NT) : 751
Best Gene Model Blast : Link to GSTUMT00006973001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_01247
Accession: ref|XP_001247476.1| Score: 472 E_value: 1e-45
KEGG Definition: hypothetical protein
Accession: fgr:FG08448.1 Score: 444 E_value: 1e-42
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3780 Score: 232 E_value: 2e-20
PFAM Definition: Arrestin_N, Arrestin (or S-antigen), N-terminal domain. Ig-like beta-sandwich fold. Scop reports duplication with C-terminal domain..
Pfam Number: pfam00339 Score: 150 E_value: 7e-11
Swissprot: Q09729|YA4C_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1585
TTGGGGGAGAAAAGAGTTTGTTTGTTTCCGCTGCGACTACTCTATTGTTG
CTATATACTACCTTTGGAATTGCCGGAGGATCGTCGTTGTTTATTGGGAT
AAATTATTGAGGAGGGAAGTTTGTCAATATGCCTCTTCTGAACCGAAGTC
ATAGCCATACGATCCCTTATTGTGATATTAGACTGGACAACAATGTGGTT
GTGCTTAGGGGAACTCCAGAGGAATCTGCTGGCGCAGCGCTGAAAGGAAC
ACTTGCTTTCTGCATCACAGAATCTGCCGCCATTCGGTCAATCGCTTTGT
CGTTGTTGGGCGTGAGAAGGCTGCATTGGCAGGAAAACTCCACAGCTTCC
GGCATTTCTGTCAAGCCGGTTAAAAGTGAGAGCGTAGTGTTCGTGAAGAA
GTGGGAATTCTTGGAGTTTTCTCACAGGAACCCAGTCACACTGCGCCCGA
ATAATTACGAGTACAGCTTTGAAACTGTCCTACCTGGCAACCTTCCCGAA
TCAATCGAAGGCCTAGACCATGCTCAGATATTCTATCGGCTAAAAGCTGT
GATCGAGAGGCCCCGGTTTGCGCAGAATATCGTTGCGAAAAAGCATTTAA
GGGTAGTACGGACTTTGGGCCCTAGTGCATTGGAGCTATCACAGGCTATG
TCTGTGGAGAATATCTGGCCCAACAAGGTGGAATACTCGATTAGTATTCC
CAGAAAGGCTGTTGCTTTTGGATCGTCTATTCCTATCGATATTATACTTG
T

Sequences in the Contig:

SY0AAA25YI15FM1 SY0AAA42YC18FM1 SY0AAA55YJ11FM1
SY0AAA56YM08FM1 SY0AAA59YI20FM1 SY0AAB15YO13FM1
SY0AAB19YN24FM1