Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1584
Length(NT) : 739
Best Gene Model Blast : Link to GSTUMT00005021001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein MGG_01326
Accession: ref|XP_363400.1| Score: 693 E_value: 3e-71
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01326 Score: 693 E_value: 2e-71
KOG Definition: No Hit Found
PFAM Definition: Het-C, Heterokaryon incompatibility protein Het-C. In filamentous fungi, het loci (for heterokaryon incompatibility) are believed to regulate self/nonself-recognition during vegetative growth. As filamentous fungi grow, hyphal fusion occurs within an individual colony to form a network. Hyphal fusion can occur also between different individuals to form a heterokaryon, in which genetically distinct nuclei occupy a common cytoplasm. However, heterokaryotic cells are viable only if the individuals involved have identical alleles at all het loci..
Pfam Number: pfam07217 Score: 687 E_value: 4e-73

Sequence:
>Contig1584
TTGGCTCATTGGAACAGAATAAACAAACAAGCGAATAGACAAGACAGCCA
AACCGTCAACGTCAGCTCAAATATTCAGGTCGTACAGCCATGGCGGGGTC
GACATTTTCCTCCCCAATGCTTCTACCCCTGTGTCTGGTACTGATTTACG
CAGCACTCCCAGCGCATGCTTTTGGGGCCGGGAATATCGCTTCGGTTTCA
ACGGTTGAAGGACAGAACTGGAGACATGGTGATATTGAGGATGCACTGTT
GAGCATTTCCATGGCAGCAGTGGCCGGTGGGAAGAGGTTTAGTTTTATGG
ACGTGAAGAGAGTGTACTTTGGAAACTGGTTGAGGGATTATTCGCAGGCG
GTTGACGTTGGTGCCTTGAAATATGTTGAGGGACCTACGGTCAGGCTTTT
GCTGTCGATTCTGAGCTTCATGACTTTCGGGTATGCCACGGGAGAGTTCG
AAGTTACGGACGAGAGGTTGGGATGTTACCGGCCCGAGGAGCACATTGAT
AATCCGAAGGATTATGCCGATAACGAGGATGCGCGGCGGTATGATCCTCG
TCTTCGAGGACCTGTTGACGAGGCTACCGAGTTATCCGTTGACCCTCAGA
CCGGAATGAAGAATTATATCGCCAATGAGAGGATCAGGAACTTGCGAAGC
GGAGATCCGATGTGTACTAGCGCCGGGTTGGTCCGGCATCTGTTCGGAAG
GAGTATCCAACTCGCCCGCAATTACGGACAAACTGGTAA

Sequences in the Contig:

SY0AAA55YI12FM1 SY0AAA7YN08FM1 SY0AAB38YP14FM1
SY0AAC13YO03FM1 SY0AAC52YJ20FM1 SY0AAD57YK06FM1
SY0AAD60YH07FM1