Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1583
Length(NT) : 1796
Best Gene Model Blast : Link to GSTUMT00009959001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: ankyrin 2,3/unc44
Accession: ref|XP_001649301.1| Score: 415 E_value: 2e-38
KEGG Definition: ankyrin repeat protein, putative
Accession: tva:TVAG_291510 Score: 403 E_value: 2e-37
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 374 E_value: 2e-36
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 121 E_value: 5e-07
Swissprot: Q4UMH6|Y381_RICFE

Sequence:
>Contig1583
TTGGGTCTTTTTCCTCCCCGCCCTACATCTACCTCCTGGCAACAAATCCA
CCTCCGCACAAAAAGAAAAAAGTGCTTTACCTCTCTCAAACATCCTCTGC
GCGCCTTTACACAAGGTTCGCCCATTATAATCAAACGCGCACTCATCTCT
ATGGAATTCGTGGTCAACAGACAATCAAAGACCGTCTTCTCCCAGCCAGT
CAAGTTCGCCATCCAGATCCAAGCCGGTCCGACGGATAGTTTCAGTGCCA
GGGATTAACGCAACCACAAGAAAATGGGTTTGCTTTACTTCCCTGATGAG
CTATTGCTCCTTGTAGCGGAGAACCTAGAGGATGCCCGTGACCTCAGCTC
TCTTCTCAGGACGAACACTCGCCTCGCTTTTACGCTGTCTCCGCTCCTCT
GCAAGCTCGCCGCAGCCCCCAAGTATTCCACCAGAGCTATATACTACGCT
GCAGCGAACCGAGATGCGGATATGGTGCAATACATTCTTGAGAAAGGAGC
TACCATCGGGCTGGCCAAGTTGGATGGCGAAAAGATCGGTGATGAGGAGA
AAATGTGCTCGAAAGATATTGTGGATTTTGTAGTGAAGAAAGGGGCCAAC
CTTGTCCTCAACAATAACGACAACAATGGAGATTTCCGCGCAATCAACTG
GGCTGCGTGGAACAGAAAATTGGCCATGACGAAATTCTTGGTGTCTAGAG
GTGCAGATATCACCTTCGTTCCTACGACTGACGACGAGAGTGTTCTCAGT
GACGCTATTAAGGGTGGCGAACCCGAGATTGTCGAATTCCTCCTTGATAA
CGGTCTCAGCATGGAAATCAACGATTACCTCGGAACTGGCCTACACGTCG
CAGCCCAAGTGGGCCAACTCTTGGTAGCCCAGCTATTGGTGGACCGTGGC
ATCAATGTCTCTTCTCATAACGGAGATGGGGAAACTGCTCTCCACTGCGC
TGTCACCACTGGCAAAGTGGAAATGGTCGAGCTCCTCCTCCGTAACAAGG
CAAACCCCAATATCGGAGCCAAGTTCGGAGGAAACATCCTACCTCTACAC
ATCGCGGCACAGAACAAAAGGTACGATATCGTTCGCCTCCTCCTTTCTCA
CGGCGCAGACATCAATGCTACGGATTCGGAAGGGCGAACAGCTCTCAGCT
TTGCCGTCTCAGCTGAAGACGAGCAGATGGTCAAACTCCTCCTCGATAAA
GCCGCCGACATTAGACTCGATGACTATCATGGCGCCACACCCTTGCACTT
TGCCTGTGAGAAGCCGGATGTCTCCATGGTTAAACTACTCCTTGATAACG
GCGCCGACATCAATGCTCAGGACGGTGACCTTTGGACCCCACTTCATTGG
GCCGGTCAACACGTCAACGTTGTCAATTTTCTCGTGGAGAGAGGAGCTAA
AGTCACACTTAAAACTAAATCCGGCCATATGCCTCTTGATCTCGTGAGTG
AGAACGAAAACATTTGCGCAATCTTGGGAAACGCTGCGAGAGCAGCTAGT
GTTGATGTTTAGACTTTTTTTCCTTTTCTCTTTTTTCCTTTGGATTTGCA
TAGATTACCCGAGTAGAATATCCCGCGAGATGATGATAATGATGATGGAT
AGGTTAGACTGTGGGTTAGACCATTAGGGAGCTTTCTTTTGGGTTACCGT
ATTGCTGTGTTTTTAATTGCCATTCTTGCGCTTTTATTTCCGTTTGTCTG
TTTGCTTCCCTTCCCGTTGTTTAGATGTTTAGATTTTCACTATAGACCCC
CATACAACTGTATATACCCTGGCATACGTTAGATTCATGTACTCAG

Sequences in the Contig:

SY0AAA25YK17FM1 SY0AAA25YK17RM1 SY0AAA55YI06FM1
SY0AAB36YO06FM1 SY0AAB38YE14FM1 SY0AAB40YP22FM1
SY0AAB51YL17FM1 SY0AAB6YP21FM1 SY0AAC28YP10FM1
SY0AAC57YH02FM1 SY0AAC61YL03FM1 SY0AAD59YA01FM1