Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1582
Length(NT) : 880
Best Gene Model Blast : Link to GSTUMT00002416001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: chorismate mutase/prephenate dehydratase
Accession: ref|XP_754063.1| Score: 440 E_value: 9e-42
KEGG Definition: chorismate mutase/prephenate dehydratase [EC:5.4.99.5 4.2.1.51]; K04093 chorismate mutase; K04518 prephenate dehydratase
Accession: afm:AFUA_5G05690 Score: 440 E_value: 5e-42
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2797 Score: 440 E_value: 2e-44
PFAM Definition: PDT, Prephenate dehydratase. This protein is involved in Phenylalanine biosynthesis. This protein catalyses the decarboxylation of prephenate to phenylpyruvate..
Pfam Number: pfam00800 Score: 423 E_value: 2e-42
Swissprot: O67085|PHEA_AQUAE

Sequence:
>Contig1582
TTGGGTCTCCCTCCTCCTCCTCCCTCTTCCTCTACTCCTGTTGGTATTCC
GTATTCAGGGGCTTGTGTATCGATTATTTGAGTTATGGTTGCTTCTACCG
CTTCGGATACCACTGGTATACCGGTGTCTCAATATCAAACTTCTTCAATC
GAAGCAAACATGGCTTCTACCTCGCCGCTCCCTTCTGTGGCATACCTTGG
ACCCAGAAGTTCATATTCTCACCAGGCAGCGTTAGAATGCTTCGACCCAG
CAAAATATACCTTTGAACCTCGGGCCGCAATCGCCGACGTCTTCACAGCC
GTCCAAGCCGGCGCAGTAGCTTACGGCGTAGTCCCCTTCGAAAACTCGAC
AAACGGGAACGTAGTCTTCACCCTAGACCTCTTCTGCGACCGCACTCGCT
CCTTCCGCGACACCTTCGTTTGCGGCGAGACATACCTCGACGTGCACCAC
TGTCTCCTCTCGAGCGCTGCATCGCTCTCCAGCGTGGCCAGGATCTACTC
GCACCCGCAGGCCTTTGGACAGTGCGAGAACTGGCTCAGCGCAAACGCGC
GCGGCGTCGAGCGTATCGACGTCTCGTCCACCTCGAAGGCCGCGCAGATC
GTTGCGGGGGATGCGGGTGCCGCCGCTATCGCGAGTAGGGTCGCCGCCGA
CGTGCACGGGCTCAGGGTCCTCGCGGGGAATATCGAGGACTCGGCGGATA
ATACTACTAGGTTTTTCGTGCTGGTTGCGCAACCGGCATTGAGGGCTCCG
GTCTCCAAAGGGCATGGGGAGACGGATAAGACGCTTTTGTCGTTCACCGT
TGATCACGAGATTCCCGGGGCGCTTTGCGATAGTTTGAAGGTCTTCAAGG
ATTTTGGGCTTAATCTTACGAGCATTGCGA

Sequences in the Contig:

SY0AAA55YH21FM1 SY0AAB57YN20FM1 SY0AAB61YM15FM1
SY0AAD56YE02FM1