Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1581
Length(NT) : 1101
Best Gene Model Blast : Link to GSTUMT00005090001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_05796
Accession: ref|XP_001592874.1| Score: 204 E_value: 3e-14
KEGG Definition: hypothetical protein
Accession: fgr:FG00727.1 Score: 191 E_value: 5e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1581
TTGGCAAAGGAGGAGGAGGAGAAGAGAAAATTGGGAGACCAAACAAAAGC
CACCCGATATCCCTTTCCCCATTTCCTCTCGCTTGGCCTTATTTTCTTCA
CTTTCATTCTTCTGTCTCTCGCCTTCTCCCTCTCTTTCTTCCTTCATCAC
CGCATTACAATCCACAGGGTATCATACGATTCTGTACAGGGTCTATGCTT
GTTTGCTTATATTATCGATATTCCATAACCTCGCACTCAAGTTTCGTCGG
GTTTCGGCACCGGTAGTCTCACACCCAAGCTTACGTCTCTATACTGGCAA
GCAACAAACAGCAGCAACAGCATCCTATTATATTTCTTATCCATCATTCT
CATTCATCGCCTCTTCTTTTCTCACCTATCTCTCTTCGCTGTGTTTGATC
TTATCCCCCAATATATATACCGCTGGATTTCCACTGTGTTTAGCCCCACC
AGCCCTCTTACCGGCTTTATCGATACGTTCCACCGCCGCCACCACCACTA
CCATTATCACAATAATAACTCGGCAACACAAAATACAAGGGCTCGTGGGG
GGCAGCCGCTAGCAATACAGACCATATGTCTGCACATAGTCTCCACGCGT
CTGTGCTTATCCTCCCTAATCCCCAATTATCGAGCCCGGAACACCTTGCT
TATGTACCCCGAGTGAAGGTAGGTTATTCAACACTGGGCACCTGAGTCTT
GGCTCTTAATATCTCCACCCCTCTGACGTTGCCCGACCCCACAGAAAAAC
ATTACTTTCGCTATCGATATCTCTGCCAACATCCGAACCCTTCACACGGG
CGTCGCTTCGCAGGGTGATGACATCTCCGGCTTGCTCTATGTGCCTATGG
TAAATGAGACCACGACATGCCATGGCCTCTCTTCTGTCCCTACCAACGTT
ACACACAAGGATGACCTTCCGGATGCCATCTACGATTTGATTGCTTTTGC
GCCTTGGATGTCGAGAGACTGTAGTACTAGATTTTTGAAGGCCGCCCAGG
TGGACGCAAGTGTTGTTAAAGGATTTATATTTTATCTCGATGATAAAGCT
GCGAAGATTCCCGAGGTGAAGGATCCTTATTGGCATGGTGTTCCATTCGA
T

Sequences in the Contig:

SY0AAA54YG17FM1 SY0AAA55YH13FM1 SY0AAA58YG13FM1
SY0AAB51YG06FM1