Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1580
Length(NT) : 1829
Best Gene Model Blast : Link to GSTUMT00003664001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1580
TTGGTGGAATGCTCCTTCACAGCCTGCACATCAACAACACGCTCAGCATT
ATACGTCCCTCGATCCAATGTCCCACTTTGCTCCTCCGCCTCATGCCTTC
CCTCAGCAGTTTACACCCCATAACTTTCCAACAAACCAGCATCCCTTTGC
AGCTACTGGTGCTGTCACAACGGCCTCTCCTCAAATTGCCACAGCTCCAA
TTACAGCTGCACGTACCAAACAATCGCATAAACCTCCAAGTATACAGCAG
AGCTTTGGACCGAATGTTGTGCGAAACGTAGCGACCTCAACTCCAAATGC
AGCAACCCTAACCACAAATGCAATGACTTCAACCACAAATGTAACGACTT
CGACCCCAAAAGCAAATGCAGAGACCCGTGTCAAAGGGTGCCCTAATGTA
ACCGTATGGTCGCCCCATGATCCGTCGCTACAACTCTCTTTGGACTTCCT
AAAAATGATATCAAGTGTTGCGCTCGGGGGCGAGCCGTCAGCATCGGTAG
GCCCGCCAAAAAAGAACCAGAAAGTAGCCAGTGCTGCGAGTACTACGAAA
GCTCAGCCTGTTAAAACAGCCGCGCCTCCCAAATCTAAGCTCCCCGAGGA
CCCTGTTGAGAAGGTTAGGTATCAGATTGAAGATGCATTGGAGTGCGATG
GAGACGATGATATTGAAGACATCCGTAAAGCATCCAAACAGGTTTGGGAT
GTAATCATCGGGATACGGCCTGAACAGTCTAAGCTGGTTGAAGTAGCTGT
ACGCGCAATTCTAAAGGTCGGCGATAATCAAATCTTGAGGGCCCTTGGGG
AGTCTATCCTATTCTCAATAAGATTGCGAAAGTGGATGACAACCGAGTGG
AACAGAGATAGAAATAGTCCTACAGTCTTCTTGATACTAAAGCTGTTGTA
TAAGTTCTGCGTATCTGAGGAAGATCTTGAACAATCATCGTGGATCAAGG
CTCTAAAAAGTATTGGGTCGAAGTCAGAGGATCCAAAAACAAGGGAAATT
TGCATGGCAATCACAAGGAGTGCTAGAGAACGCTCTGCTAAGAGGGAGAG
GGAAGAGAAAGCTAAGGAAAAGCAACAGAAGCCCGCGTCATTAGCAGCCT
CCTCTTCTCTATCTGACCGCACTAATGATAAAGAGAAGTCTTTGGGGAAT
GGGGCAGCAGCCAAGAGTGAGGCCAGTAGTAATGTTAATGTTGGCATTAA
ACGCAAGAGCGAGGACGATGCCAGAGTTGGTCAAAATACTATCAAGAAGA
TTGCTTTGGGTGAGGGAAAAATCCCCGCTGTGTCGAGCTCCCCAAATCCA
AAGACTGGTTTATCTGCCGGTAACTCTAAAAATGCAGCGACACCTACCGC
CGAGAAGAAATTGACTACAAGTACTGCAACTTCCACTAGCGCAAATGGTT
CTTCTGCATCTGCCAAGCCGAAAACCACTACTTCCGGCTTTTTTTAAGTC
TCTCCAGGGCAACCGTCCAGCCATTGTCACAAAGCCTGCTGAAAAGAAAT
CCACCCCCAACCCTGAATCCACCGCCAGCACATTCACTAGTATTTTCGAC
CAGCTTGTCCGCCAACAAAAGGAAGGCACTACCGGACTAAGGCCTGATTC
TGATTCTAAGAAACGTGAGGCCGATGAAGACCAAAACGGCTCCAACAAGA
AGGTCAGAAAGAAGAAGACTGTCCGGTGGAAGACCGGGGAGGATCTTGCT
AGGGTCAAGGTTATCGAGTGGGTTGAGCCAGAAGGAGAATACTATGGAGG
CAGTAGCGGACACGAAAATCATGAATATGGAAATGCCAGGAATTTTGATG
TGGAAGAAGGTAGGGAAGCGTTGGCTGCC

Sequences in the Contig:

SY0AAA55YH09FM1 SY0AAA6YI10FM1 SY0AAC11YK24FM1
SY0AAC13YB17FM1 SY0AAD39YF01FM1 SY0AAD60YG10FM1
SY0AAD62YJ14FM1