Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig158
Length(NT) : 697
Best Gene Model Blast : Link to GSTUMT00010683001 E-value : 1e-106
Numbers of ESTs : 4

Blast Results:

Nr Definition: CTP synthase
Accession: ref|XP_001246057.1| Score: 388 E_value: 8e-66
KEGG Definition: hypothetical protein
Accession: yli:YALI0B05368g Score: 369 E_value: 3e-63
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2387 Score: 538 E_value: 8e-56
PFAM Definition: CTP_synth_N, CTP synthase N-terminus. This family consists of the N-terminal region of the CTP synthase protein (EC:6.3.4.2). This family is found in conjunction with pfam00117 located in the C-terminal region of the protein. CTP synthase catalyses the synthesis of CTP from UTP by amination of the pyrimidine ring at the 4-position..
Pfam Number: pfam06418 Score: 501 E_value: 2e-51
Swissprot: O42644|PYRG_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig158
TTGGTACCTTCCTCCTCTCCTTCCCGCCTCACGCTTGTTCACAACGACAA
ACTGGGTCTTGTCTCTCTTTTCCTTCCTTTCCTTTTGAGAAAATTCTTAC
CAAATTTGAAACGAAGGTTGGAAAGATGAAGTACGTACTAGTTTCTGGAG
GTGTGATTAGTGGGATTGGGAAGGGCGTTATTGCCTCTTCGACGGGTCTA
TTGTTGAAGACCATTGGTCTTAAGGTCTCGGCCATTAAGATCGATCCGTA
CATGAATGTCGATGCAGGAACTATGGCTCCCACCGAACACGGTGAGGTGT
TTGTCCTCAATGATGGTGGTGAAGTCGACCTGGACCTTGGCAATTACGAG
AGGTACCTTAATATCACGCTTACTCGGGAGAATAATATCACTACCGGAAA
GATTTATCAGCATGTCATTGAACGGGAGGTCTGTTCTCCCTCTCAGCCAT
TAATGTTGCGGGCGAGTTTTTTTATTTTTTTTTGTTAAAATTGGAGGAAA
AATAGAGACGTGGTGATTACCTTGGGAAGACTGTCCAGGTCGTTCCTCAC
CTCACAGATGCCATCCAGGATTGGATCGAACGTGTGGCTCGCATTCCCGT
CGACGAGACTTCTGAGGAGCCGGACACTTGTATAATAGAGTTGGGAGGGA
CTGTGGGAGATATTGAATCTGCGCCCTTCATTGAGGCAATGAGACAG

Sequences in the Contig:

SY0AAA11YJ10FM1 SY0AAA15YN01FM1 SY0AAA15YN17FM1
SY0AAB13YA11FM1