Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1579
Length(NT) : 741
Best Gene Model Blast : Link to GSTUMT00004378001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001216327.1| Score: 254 E_value: 2e-20
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G11190 Score: 242 E_value: 3e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1579
TTGGATTTTCCCAGCTCGTCTCACACCCTCTCCGACTCCACGGCCGACCA
CCACTTGGACGGCCTGATCTTCCATTCTCTTTTTACAACAACCTTCCCCC
CACGGTCCTTCACTTCAAGGTTCGAACCCCCATACACTAAACTCGATAAT
CGGTACTGGGAATTTTTGCAACAATGTCTACTGGAACTCCCACTGGTGGC
TCGGGCTCGGCCGGCGGTGGAGAGAGATCCATACGCAAGCGTTTTGCGTC
TCAGGTCAAGAGGGTTCTGAGCATTAAGAATAAGCCGGGCAGATCAAGAC
GTTCAACCGTTTCCGATGGTCCTGGCGAACCTGATACTCCGACTACACCT
TTGCTGCCCACCACTGCTGTTCCTCCAATTGAATCTAAACCGAGCTCTGT
CGCCCGGCCGGGACCCGAACCAAAGGCCCAGGAAGAGGTAGAGCAGCAAA
GGGTTAAGACTCGGACTAGACCCGCTGTTCGTCAACCTAGGACCACGAAC
ATCCCACCTCCTGCTGTGTCTGCTGCTGAGCGTGCTCAAGCTCTTTTCAA
GAAGCACGGTTTGGAGGTTTCTACAGCTGATTGGCCTTTGTCAACTGTCC
TGCCCAGCGATCGTGTTCAAAAGGATATTCGTATGAGAGTTCATCGCACT
TGCCATAAGTGCTCGACTTCTTTCGGTCCTGACAAGATCTGCAATTCGTG
TAATCATAAGAGGTGCAAGAAGTGTCCGAGGCAACCTGTCA

Sequences in the Contig:

SY0AAA46YG09FM1 SY0AAA55YH04FM1