Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1578
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00005884001 E-value : 1e-171
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_06364
Accession: ref|XP_001242468.1| Score: 169 E_value: 1e-10
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G05580 Score: 161 E_value: 6e-10
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3263 Score: 113 E_value: 1e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1578
TTGGGACGCCCGTGTCCGGGGATGATAGCGGGAGTTACAGTGGGAGCCAG
GATATGGTTTTATCGGAGCAAGGGAAGAGTAGGTATGGGTACGGGCGCTC
GGAAGGCAGTATCGAAGGAGGCAGGAGGGAGAGGAGGGAGAACAAGACAT
TGATTGCTTCGAGGGAGAGGGATAAGAACGGTTATAAGCTTTCTTTTGCT
CAGGATCAGGGTTCTTCTTCTTTGGTGCCCTCGAAAACACCAAGTCATTT
GAAGTCACCTAAGAGGTCTCATAAGTTGGTGTTTGGTCTGCCGGTTAAGG
ACCCGTGGAGGCAGAGGGAGAAGGAGAAGGAAAAAGAGCGGGAGAGGGAG
AGAGAGCTGGAAAGGGAGAGGGACAGGGAGAGAGCTAGGGAGGTTCGGAG
GCCAGTTGAGAGAAGTGTGGTCAGGCCTATTGATGGGCAAAATCTGCCTG
GGCAGCAGCAAACGAAGAGTGATCTAGGACCTTATGCCCACGAGGCACAA
ATGCCGGCTTGGCTCCGCAAAGAGCTTGAGCAAGGTGGTAAACTGACCAA
GGAAACTAGATTGGATCATGCCGCTGGGCGTTTGGTTAGGGTTGTCACGG
TCTCCAATGAAACTCCCGATCTCATCCCTGTGATTGCGCTTCTCTGTGAA
CACGATCCTCGTGT

Sequences in the Contig:

SY0AAA55YG17FM1 SY0AAA5YE21FM1 SY0AAD47YJ20FM1