Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1577
Length(NT) : 1231
Best Gene Model Blast : Link to GSTUMT00005254001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein AN9426.2
Accession: ref|XP_868808.1| Score: 186 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: ani:AN9426.2 Score: 186 E_value: 2e-12
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 157 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: P46824|KLC_DROME
Gene Ontology:
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig1577
TTGGGCTGAAATATTTGCTCAACTTCTCTACCTCTACGACGGTCTGATTA
AGGCGCCCACCAGCGAAAAGGTGTTGCATAATCAGTTATGGGTTGAGCGC
GCAATATTCGTTGCCTGGGGGCGCGCAGTCGGCCTCTCCGCCGATGCTCG
TTCGAAACCGCTGGCGGGCGATTTCGACGATGGGGATCTGTTGCGCGCAG
TGGAGATTACTATGAAGAGTGTAGTGGAGGTGTGCGCTGATAGAACGATG
GCCTGGAGGAACTTTGGTGTGAGGAAGGGTGGGAGGGGTTTTCTTCGAAA
GTTTCTTTGGAAGACTACTGAGGAGGAGGAGGAGGCGTGGCAGATCGCAG
ATGGGAGGAAGTTCAAAGACCTGGTGGACGAAATGAAGAGAGTCAACTGT
GATCTGGAAAGGATTGTTTCTAGGAATTGTGTCCCGGCACACCCGGCGGA
ACGGGAATTCGAAGACGAGGATGAAGAGGAAGAGGAAGAAGTATTGGAGG
AGGATGCAATGGCCGGAATCCCACCGCCAGCGTATTACCATCCCGTCTCT
GCTCCGCCATCTCCGCCAGCATCCAACTCTCCGTCACCATCGCCATCCCC
GCTCCCCTCAAACCGCCATAAACCCCGCCGCAGCAGAGACCTTCCCCCTG
CCCTTGCGGCCCTCCTCACAACCTACAACATGACAGTGCAGACCTATGGC
CCCTCTGCACCAGAGGCTCTCTCTATCGAAGACCTCCTCTGGCACAATCA
CTTTTCCCAAGCCCCTGACTTCTCTGCTGCACACACCGCGCAAATAACCC
ACGGCCGCGATAGTCCGGAAACTATCCGGGCACTGCACTCTCTTGCCCGT
AATCTCTCCGACAAACAGGATTTCGCTACAGCACTCGCGCTCTACACAAT
CTGCCTTTCCCGTGAGACCCGTGTGTATGGTAACTCGCACCCGCAAACAC
TCCGGTCGATGTCCGGCCTTGCTTTCGCATTCCAGAACGTCGGAAAGGAC
GAGGATGCGCTGGAAATGTACCAGCGAGCGCTAAGTAGATGGGGAGACGT
GGTTAATGTGTATACTGTGCGGGCTAGGGTAAATGTCGCTAGTATATATG
CCGATAATGGACGATTTGAAGATGCGGAGGAAGTGCTGAGACGCACCGTG
CAAGAGGCCGGAGTAAAACTTGGGGGTGGTCATGAGAGCACCAAATTAGC
GATGCATAACCTCGGATTCTTGCTCAGAGCC

Sequences in the Contig:

SY0AAA55YG11FM1 SY0AAC25YE20RM1 SY0AAC35YM09FM1
SY0AAC37YF11FM1