Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1575
Length(NT) : 967
Best Gene Model Blast : Link to GSTUMT00010178001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An04g09290
Accession: ref|XP_001402285.1| Score: 427 E_value: 3e-40
KEGG Definition: hypothetical protein
Accession: ang:An04g09290 Score: 427 E_value: 2e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P46974|ZMS1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0045449 = Biological process: regulation of transcription

Sequence:
>Contig1575
TTGGGAGCGCTCCCACACGAAGGAAAAGCCATTTGAGTGCCCAGAATGCA
CGCGCTGTTTTGCCCGCAGGGACTTACTTCTCAGACACCAGCAGAAATTG
CATATGACGACCACTCCCAGCAGTCGTCCAAGAGCCAGCGGTCGGAGAGA
AAGCACGAGCTCCGTAACATCCACTAATCCTGGGAGGGTCCGGAAGAACT
CAGTTTCTACTACTGCCACTGGCCCAGTCAGTCACGGTGATGGTGGGGCT
TCCGCCATGAGGGCTAGGCCTAGGGCGAATACCATTGCCCACGTAGACGC
CTCAACTCTTGGGATGCTTGCAGCTGCCAATGCGAATGTGAGCCGTGGAA
GAAGTAGTGGCAGTGCTCAAGGTAATATGGGCGGCACCGGCGTAGGTTCT
TTGAATCATGAAGAAACCAGGCACGCGGTGCCCAAAATTGATACATCGCT
GTCATCTTTGGATCTGGGTGGGATGATGCCTCGTTCTGCCTCCATGCTTC
CTTCCGAATATGAGCTTGATGGTTTGTTGTTTGGAGGAACTGTCAATCCG
GCGGCGTTGCACTTCAATATGTCACCCCTTCAGCAACCGATTGGGACGCC
AACTTCACCGTTCGGGCCCCCATTCCCTGGCCTTGATTCTTCGTACTATA
TCGAAGATGAAGATGATTACGAATGGATGAATCCACTTGGTGGTGGAAGT
CTTATGGATCCTGTTGACCAGTCATCACCCAGTGCTTTCAGCACTACATC
GGCCAGTGGAATCAGTGAGGTTATTCTGAATGAGAATCAAGGATGGGGCA
GTCAGATGGGTATGGGTACGGGTTCCGGAAATGCCATCAATTTTAATTCT
CCAAATGATTTCTCGGGATCGAATTTTCATCATGAAACGCCACCGCCACC
GGGAACCATCTCCCCCAAAACTCTTTTGGCTCAGCAATCGTCCCATGAGA
ATTACTACTCCGGTCCA

Sequences in the Contig:

SY0AAA55YF16FM1 SY0AAB6YE09FM1 SY0AAC10YC23FM1