Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1574
Length(NT) : 1004
Best Gene Model Blast : Link to GSTUMT00010583001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein An12g00850
Accession: ref|XP_001395174.1| Score: 373 E_value: 7e-34
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 373 E_value: 3e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1574
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTCTGTTCTCCCAGACC
TCTCTGAATATCTTTCAATCCCTACGATAATTTTAATTCTTGTCTTCCTT
TTTGTTTCTCCCACCCTTCCAGACCTGGTTGAAGATCTTTACGACCATCC
AAGTCCACATTCAATCACTACCCAGCCAAAACGCAACCTCTTCTGACAAT
CATTGATCGATCACATGGGTAATTGGCCATCAAACACCCGCTCTGAGGAC
AATTCCTCGTCTGAACATCATGGGTATCGCACGATGACCAACAGTAATAA
CAGCGGTGACTATAGCGGCAACGTTGACTCAAACAACAAAATCTACGGCG
AGACCATCAACATTTCCAAGACCTACGCCCATTGTGACCAGAGGCACACG
GGCCTGTCACAGGACCATCGCGAAATATTGCAATGCCTACACACTTCGAA
ATACACCAATCATAGAACTCGCGTTCAGAAGCCAGAGGAGGGAACATGCA
CTTGGATTACCGAACATCAAAAGTATAAGGAGTGGTTGGGGAAGGAAAAA
TCCGGTCTCCTCTGGCTGTCGGCGGACCCAGGTTGCGGGAAATCAGTCGC
CGCTTCTTTCCTCGTAAAGCATCTGCAAATCCATACGGACGCCACAGTTT
GCTATTTTTTCTTCAAAGATGACAACGATGAACAGAGGCGCGCAACATTC
GCTCTTTGTGCTATACTACATCAACTTTTTATGCAGAACGAGACGCTCTC
CAGTTACGCCGAGAGAGAGTTTAAGGGTAAAGGAAAGGGGTTTACCGAGG
AGGTCGATACATTGTGGGATATTTTGGTTGGGGCAGTAGCTGAGGGGGGG
TGTGGCAATGTAATTTGTGTGGTGGACGCGCTGGACGAGTGCGAGGAAGG
GACTCTGACTCGGCTTATCGATCATATCACAAGTCTACCTGGGTCACAGA
CTTCCGATATTCCTTTAAAATTCCTAGTTACGAGTCGCCCCTACCAAAAG
ATCG

Sequences in the Contig:

SY0AAA25YK07FM1 SY0AAA55YF13FM1 SY0AAA56YN09FM1
SY0AAA57YD10FM1 SY0AAA57YJ09FM1 SY0AAB36YA15FM1