Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1573
Length(NT) : 1086
Best Gene Model Blast : Link to GSTUMT00011467001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001214286.1| Score: 363 E_value: 1e-32
KEGG Definition: hypothetical protein
Accession: fgr:FG10917.1 Score: 352 E_value: 1e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1573
TTGGACCTACTCTACCTATAAAATAACGTACTATATCTCGGAGTTCCAAA
AGGAAGTCTTCCTCCCAATAGAAACAAAAAAAGGAAAACCTGATGGACAC
CCAAGCCAACACCCCCTTGCTCCTCCCCGCCCCAACCCGCTACCCGCCTC
CCTACCTTCTATTCCTAGACCTCTATGTCCTAATCTCTAACCTCCCCTCC
TTGCTGGGTATAATCCGCCCCGTGCGCACCTCCAACCCGCGCGCGGAGCT
CTACCCCTACTCCCTAGGCAACATCTCCTCCATGGTCCTGGGCATAATCC
TCATCCTCGTTGGTCTCGCCTCCCTGCTGCTAATCCCTATATGGTTACTC
GTACCTGGCGGGGTGTGGCTCTGCTGGTTCATTGGCGTGACGGTAGTGAC
ATTGGTTTTCTCCAAGTTTCTGAATGGATTTGCCGGGGATGTTGTGGTTA
GTAGTGGACAATACGTGCACGGGGACGCGGAGGCGGAGGACGAGAAGTGG
TTTTTTGTGAACGGGATTATGACGGGTGAGTTCTGGCTGAAGACTAATAT
TGAAGAGGCTGAGAGGCGGTTTGGGAGGAGGATTTGGGGTGTGCATAACC
GAAGTTATGGATTGGTACTCGACCTACTGCAATGCCTTATCCAGCGGGAC
CTACGCTACAGTTCTACCTGCGTACGCGCTTTATATCACAACCTCCGCAC
CGCGCTGCTGGAACTCGAATCCGTCCCTCCCTCCCCCTCCTCCTCCACCT
CCATCCCCGCTTCCAAGCCGAAGCACAAGAAGGTGGTCCTGCTCGCGCAC
TCTCAAGGAGCGCTCATCGCGTCGCTGGTGCTGGATATGCTCTACGCCGA
CATACCCAGGTCCCTGCTCTCCCGCCTGGAAGTCTACACTTTCGGCAACG
CATCGAATACATTCAATAATCCACTCTACCGGCACGGCGATACGAACTCC
GGTGCGCTGCGGTACCTTGAACACTACGCGAATCGCGGGGAGTACGTTAG
CAGGGTCGGAATACTGGGATTCATGACTAGTGGGGATGTTACCGAGGTAG
CGGAGGGCTGGGGGAACCAGTTTGCTGGTAGGGTCT

Sequences in the Contig:

SY0AAA52YI15FM1 SY0AAA55YF09FM1 SY0AAB15YE11FM1
SY0AAB36YM23FM1