Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1572
Length(NT) : 1123
Best Gene Model Blast : Link to GSTUMT00004784001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1572
TTGGCAGTAGAGCTGCGTCAAACCGCAGCCTATTTTCAAAATTTCTGGAG
GAGGGTCTTGGGACCGGGAAGCGGGACAAGAGGCCTACCAGCGGATCAAA
CGCGTCTGATTCCTGGCGATTTGATGATCTTTTCTCCTCGCCCACAGAGA
GGAAGAAGGGCAAAGAGAGAAGTACAGTGTCCTCAGATGACCCATAGAAT
CGTTGCAGGATCGGGATGAGCAAACAAATGGAGCTAGGGGACCCCAACCT
TGGAGATGGATCTTGACTCCCGGTGGAACGGTAATCACACCACCGCAATA
TGATTCAGATAACCAAGCTCCTAAAGTGGGGACACAGAGCTTCGAAAGAG
CTAGTGCACCGCGTTTGGGGAGGTTAAATGAGGAGGATACCGAGGATGAA
CATATCATTAGCGAATCAGACCAGCCAGACGTTGAACAGGAGGAACTAAG
AACAGAGAGAAAGAGACGTAAGCCTTTCTTCCTCTTCGGCGAGGGACCTG
CGGCTTCTCCGGCTCCTCCCCCGGCCCCCGAACCATCCACGCGAAAGTCT
CCGACACTTCCAGCTTACCTTCGTGCTGAGATGGAGAGTTCATATCAGAG
CACAAGGATCGACGATGACTCGGATATTGACGATAACCAGCCAAGGGAAG
CAGATATTGAGAATGCTTTCTCGAAAATGAAACCCGGCCCATGCGATACT
CCCGTAATGGGTAATTCCAGAACTGCAGTTTCCTTGACCCCGCTTCTCGG
AGATAGAAGTCCAACTCCTCGGCGAGGTGGGCCTTCTCTAAGGCTCGATA
CTGACAATTTCAAAGCCACTCGCGGGCCGGGCGAACGTTCTGCACCAATG
CCCAAGGCACCCAACCCAAGTGCTTCGACGAAGGGGCCCAAGTATAGAGG
TGGCAGCGGCTCCTATGGCTATCCTGGACCCAGCCATGGTGCAAGAGGGA
GGGGGTTTAGACGAACCATGGGAATCAGCGTCTGAAGGAAGTGCCTCTGG
GAAATGGGGTAGTCGACGTGGCAATCGATGTGGCCATGGGAAAGGCCCTA
GCACGCGTACATGGAGGCGTGACCTTGATTCGGAAGATTTCCGAAGCCGA
TCTGTTTCCCCGCAAATTCCACC

Sequences in the Contig:

SY0AAA36YA18FM1 SY0AAA55YF06FM1 SY0AAC49YH20FM1