Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1571
Length(NT) : 1302
Best Gene Model Blast : Link to GSTUMT00002481001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_06272
Accession: ref|XP_001242376.1| Score: 758 E_value: 2e-78
KEGG Definition: ATP-dependent Clp protease, putative; K03544 ATP-dependent Clp protease ATP-binding subunit ClpX
Accession: afm:AFUA_1G02170 Score: 711 E_value: 3e-73
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0745 Score: 664 E_value: 4e-70
PFAM Definition: AAA_2, ATPase family associated with various cellular activities (AAA). This Pfam entry includes some of the AAA proteins not detected by the pfam00004 model..
Pfam Number: pfam07724 Score: 206 E_value: 6e-17
Swissprot: P38323|MCX1_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0051082 = Molecular function: unfolded protein binding

Sequence:
>Contig1571
TTGGCATGCACAACCAGCCCCGACATCTGTGCTATTACCGATACCGGCAC
TCGAGTATACTATTATTTTCCAGTGACGTGGGGTAAGTCGCTTTAGTCAC
GAACAGCCGGAGCTCGTTACAGCGCGGAACGTCTGGGTGAACCTGCGCGA
TAAACCCCATAACACCACCAGCTTACTCTACCTTCTATCACACCCCCCCT
CTATACTTCAACTCTTGCTCCAGAATACCCGTCTCTTTCCCATTCGTGGT
TTCATCCCATTTCTCCAAAGTCTAACCCCGGCATGCTTCTCGGGCGCCCC
CCATTACTGTATCGAGGTATCCGGCCGTCGTCTTTGGCTGTAGCACAGAG
ATGGATGTCATCCTACGATCCTTCCGACTTTCAATTTGGGGGTGCGGGAT
TTAGTTCGAGGGTAGATACCGATACGCCAACATTCGGACCATTGGGAGAC
GCTTCCTCTGGCATTAATAAATTGACACCACGGGCTTTGAAGCAGCACTT
GGACCGATTTGTCGTGGGTCAGAATAGGCCTAAGAGAATTTTATCAACAG
CAATATACCATCACTACAAGCGGACTCAGCAGTTACAACAAAGACAGGAG
GAGCAAGATGAGTTGTTTAGGTCAAGTCAGGCTATGGGACCACAATCGCT
AGATGAGGAGATCTCTCATCAACCAAGAACCGTTCATGTACCGCCTAGAG
GGGATCGCGCATCTATTTACGATTTCTCTCCGTTAACCATTGAAAAGAGC
AACGTGCTCTGCCTGGGACCTACGGGAGTAGGGAAGACACTTATGCTGCG
GACGCTTGCACGAGTATTAGAGGTCCCATTTTCAATGTCTGATTGCACAC
CATTCACACAAGCGGGTTACGTTGGAGAAGACGCAGATGTTTGTATCCAT
AGATTACTCGCAGCAGCTAATTGGGATATCCGAAGGGCTGAAAGTGGAAT
TGTCTGTTTAGACGAGTTTGACAAGATAGCAAAACCGAAATCCCCTTATG
GCAGTAAAGACATATCTGGAGAGGGCGTTCAGCAAGCTCTTCTCAAGATC
ATAGAAGGTACTACCTTACAAATCAACACCAAACCAGAACGCCGTCCACC
TGCTGGCCTTCCTAATTCTCCAAACGGTTCCAACTCCTCGTTTGGCGCCG
GCTCAGCCGGGGGTGGTGTTACGAGAGGGGAAACCTTCACGATCGATACC
TCCAACATCCTCTTCATTTTTACCGGGGCTTTCATAGGCATGCAAAAGCA
CATCGTTGATCGGGTCGCTAAAGGTTCTATCGGCTTTAACGCACACGTGC
GT

Sequences in the Contig:

SY0AAA15YL07FM1 SY0AAA55YE15FM1 SY0AAB17YD05FM1
SY0AAB27YP17FM1 SY0AAB36YL12FM1 SY0AAD43YH19FM1
SY0AAD59YB03FM1