Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1570
Length(NT) : 1277
Best Gene Model Blast : Link to GSTUMT00010248001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_08147
Accession: ref|XP_001553317.1| Score: 549 E_value: 4e-54
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05341 Score: 518 E_value: 7e-51
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1570
TTGGCGACAAACCTTCGCCTGATTTGTTTAACCTCGTCGACTTGGTATTG
ACTAGTCTTAAATCTAAGTCCCAACAAACAGTGTCCGCGACCCTAAAACT
TATCTCTACTATATTGAGAAAACACCACCCATACTCAATCTCTACGCTGT
TGAAAGTAATCCCTGTTGCAGCTGACGCTCAATTACGCACCTTGGGTGCG
CACAACAAAGAGATGGAACTATTTTTCTCGCTGGTGGGAGATATCTCGGA
GGACGGAGACGTCTCTGAAAGCTATGGAGAACATTTGAAGGACGTATTGA
GTTTGTTGGAATCACACCCTTGCTCAATGAAAGTGCTTGCTTTAAAGAAT
TCCGCGTTCGCGGGCGGAGCAGAAGATGCTCGAGAACCCGAAAACCCAAA
GGTCAGGGATATGTATACGCACACTGTTCATCCTAACGACCCACTACTCA
GAAGTGTTGTGGATTTGTTGAAAAGCTTTTTCTCCAACACTGTTGAGACC
AATCTGACTCTCACAGCCGTGATTGTGGATCTTGCGACTTGCTCATTCAT
GAGGCCAGAAGGTTGGCTATTATTTGATCCGACTTCTTATGAATTTGACG
ACAGCGATGACGAGCGAGATGGTGATGAGTGGGACCAACTTGAGGACGTT
GAGAATGAATTGACCAGTATTATGGGGGATAGTGACGAGCAAGCCTATCG
GCGCAAGGAGAAGAAGCGAGCGAAAGACCTAAAGCGGGCAAACCGGCAAC
CAAGATGGACAAATACACCGCCAATTCTTCAAGCTATTGAGGATTTAGTA
AGCCAGGTCCAAGCTTACCGAAGAGCTATTCCAGATTTAGACGATAAGCT
ATCGGAGAGGAAGCGCGCGTTCCAGTTTACAGATGAATTAAATGATGCTT
TACTATCTAGCCCATTGCCGCAGCCTACACCCCCTACCCGAACTTCAGTT
CTAGATTCTATTTCTGCAAAGAATCTTATGAGACCCTCCAGTGCACATAC
GCCAATCGTCCGCTCTCGGCAACCCTCCGGTGGTTCAGGTCACTCGACTC
CAGCCCCGAATTCGCTTGTGCCTACTAGATCCACGATATCTACACCTTCA
CCGGCGCATGGGATATCTCCATCGGTGGGTTTAGCCAGATCTCCCGAAAG
TCCTTTTAATCATCACATGTTGGAAACCACGCAGCGAAGAATCAGGGTAT
TGCGACCAGGACAAGCAATACTACATCTCCCACCTCCACCCGAAGGTGAG
AGCAGAGAGGGAAGCGTTACGGGAATA

Sequences in the Contig:

SY0AAA53YB05FM1 SY0AAA55YE09FM1 SY0AAD24YE04FM1