Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig157
Length(NT) : 1548
Best Gene Model Blast : Link to GSTUMT00007997001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: alanyl-tRNA synthetase, cytoplasmic
Accession: ref|XP_001248510.1| Score: 1720 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An16g09320 Score: 1679 E_value: 0.0
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0188 Score: 1862 E_value: 0.0
PFAM Definition: tRNA-synt_2c, tRNA synthetases class II (A). Other tRNA synthetase sub-families are too dissimilar to be included. This family includes only alanyl-tRNA synthetases..
Pfam Number: pfam01411 Score: 1637 E_value: 0.0
Swissprot: O13914|SYAC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig157
TTGGCGAATACCGCAACGCAAACACACGTTCCCAGGTTGCCATCAACCGC
AGCAATCTTTACTTGTTGCGGCTTTCATTCATCTTCCATAATGGCATCTC
CCCTTTCTACTGTGGAGTGGCCGGCTAGCTTGGTCCGAAAAACCTTCATT
GATTACTTCAAAAATAATGGCCATACATTCGTGCCATCGTCTTCGGTAGT
GCCCCTCTCAGATCCGACCCTGCTATTTGCGAATGCTGGCATGAACCAAT
ATAAGTCAATTTTTCTCGGGACTGTGGATCCCTCATCAGACTTCGCCAGT
TTAAAACGGGCTGCGAACTCACAGAAGTGCATACGAGCTGGGGGTAAGCA
CAATGACCTTGACGACGTCGGAAAAGATAGCTACCATCATACATTTTTCG
AGATGCTTGGAAATTGGAGTTTCGGTGACTACTTCAAAAAGGAAGCGGTT
GAATACTCATGGGAACTATTGACGGAAATCTACGGGCTTGACCCTGATAG
ATTATATGTTACGTATTTTGAGGGTAATAAAGAACGTGGACTGGAACCGG
ATCTGGAGACTCAAGAACTCTGGAGAGCCGTCGGCGTCGCTGACAACCAC
ATCCTCCCTGGGAATATGAAGGACAACTTCTGGGAGATGGGTGATCAGGG
CCCATGTGGACCCTGTAGCGAAGTTCACTATGACCATATTGGTGGTCGCA
ATGCCTCTCACTTGGTAAACATGGACGATCCCAATGTCATTGAGATTTGG
AACAATGTTTTCATCCAGTACAATCGCGAACCGGATCATTCGCTCCGTTC
TCTACCTAATAAACATGTTGATACCGGGATGGGTTTTGAGCGCTTGGTAT
CAGTGCTACAAGATAAATCTTCCAACTACGATACAGATGTTTTCTCTCCC
CTATTCCAAAAAATCCAAGAGATCACAAAAGCACGGCCTTATGGGGGGAA
GTTTGGTGCCGAAGATGTTGACGGAATCGACACTGCATATCGTGTCATAG
CAGATCATGTTAGGACCCTAACTTTTGCTATCGCCGATGGTGGCGTGCCA
AACAATGAAGGTCGTGGTTATGTGGTAAGGCGGGTTCTGCGCCGGGGAGC
GAGATATGCTCGCCGTTATTTCCAGGCGCCAATTGGCGAGTTTTTCTCTA
AAATCGTTCCAACTCTGGTCCTTCAACTGGGTGATGTCTTCCCAGAAATA
AAAAAGAAAGAGAGTGATGTCAAGGAGATTTTAAACGAGGAGGAAGAGTC
GTTTTCTCGGACCCTTGATAGGGGAGAGAGGATGTTTGACGTTTTCTCGA
AAAGAGCGACGGAACATAATTCAAAGGTTCTCAAGGGCAGTGATGTCTGG
CGTCTCTATGATACCTTCGGGTTCCCAGTCGACCTCACCCGAATCATGGC
TGAGGAAAATGGTCTTGAGATCAATGAGGAAGAATTTGAGAGAGCGAAGG
CTGAGAGCAAGGAAGCCAGTAAGGCTAGGAAGAGTTCCGGAGATGTTTGA
ATTACTGAAGCTCGGCGTTCATGATCTTGGAAGGCTAGAACAAATGGC

Sequences in the Contig:

SY0AAA15YM22FM1 SY0AAA26YN15FM1 SY0AAA8YA10FM1
SY0AAC1YA23FM1 SY0AAD11YC09FM1 SY0AAD32YI22FM1
SY0AAD34YB19FM1 SY0AAD43YH02FM1 SY0AAD48YP13FM1