Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1569
Length(NT) : 722
Best Gene Model Blast : Link to GSTUMT00006417001 E-value : 1e-173
Numbers of ESTs : 2

Blast Results:

Nr Definition: acyl-CoA synthetase
Accession: ref|XP_001545851.1| Score: 562 E_value: 4e-71
KEGG Definition: hypothetical protein
Accession: ang:An16g05150 Score: 531 E_value: 8e-65
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1180 Score: 531 E_value: 5e-55
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 224 E_value: 2e-19
Swissprot: Q9P7D7|LCF2_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005774 = Cellular component: vacuolar membrane
GO:0004467 = Molecular function: long-chain-fatty-acid-CoA ligase activity
GO:0001676 = Biological process: long-chain fatty acid metabolic process

Sequence:
>Contig1569
TTGGCCACGATGCCAGATCCAGGAAGGCCCGAGCGAAGGAGAATGCCCTT
GAGCGACATGGCGCCCCAGAAGAGCTTCTGAGTCAATGGAGGAAGATTGG
AAACCTTATCCATGACACCCTTTTTCACGGTTTCCCAAACCGCAGGGACG
CCGACAAGGATAGTCGGCCTGAATTCGGCGATGTCACCCTTGCAGTTGCG
CATGGATTTCTCCGACAAAGTCTTGGGGTTTCCGTAACCCATGGTTCCAC
CCCAGAATAGACATGCGTTTTCAAACACGTACTCGAGAATGTGTGCCAGG
GGCAAAAAGACACTACAAATCGCGCATCGTTAGCCACGTTTCAAAGCCAA
CTACAAAACTAACTAAAGCTTACCCGCCGCAACCACATTCTTGTGGAGAA
GGGGGACTCCCTTAGGAGTGCCGGTTGACCCAGAAGTATACATGATACCA
CAAAGGTCTTCGGGACCAGCAGGATCAGGATCACAAGGGTTCTCCTGCCC
AAGCTTAATAAGCTCTTCAATGCTTAGAATGCGCAATCGCTCATGCGCAG
CCTTCAAGGGTTAATAAGTTGTGGGAGAAGGTGGGGGTCGAGGAAAATGG
CGGCTGCCTCGGTCTGCACAAGCGAATGGGTGAGGCCGGATTGGCCGAGA
GTGTCATAAGCAGTGACAATTGGCAGCGATTGTGATGCACAGGCTATCAG
TTGTCAGCAGTTGATTCCAGTC

Sequences in the Contig:

SY0AAA55YE03FM1 SY0AAD45YD05FM1