Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1568
Length(NT) : 937
Best Gene Model Blast : Link to GSTUMT00000590001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_06939
Accession: ref|XP_001243043.1| Score: 718 E_value: 6e-74
KEGG Definition: hypothetical protein
Accession: ang:An08g03340 Score: 675 E_value: 3e-69
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2138 Score: 446 E_value: 5e-45
PFAM Definition: DUF1604, Protein of unknown function (DUF1604). This family is found at the N-terminus of several eukaryotic RNA processing proteins..
Pfam Number: pfam07713 Score: 346 E_value: 2e-33
Swissprot: Q9DBM1|GPTC1_MOUSE

Sequence:
>Contig1568
TTGGCACAAGGGCCAACCGACTTCCTGATCTGAGTCACGCTCTGCACAAC
GCAATACCAACTTCTGCATCCAACCCCCCCCGACCGCGCCGTGGCTCGTT
AGTCATTTAGTCTGTCCCGCTCACAGGGAATCTCTCTTGGAACCACTCAA
CCTAACACAAGTGCAATATTGCTGCAACTCTTCGAACTACATGTCCGGTA
AAAGGCCCCGAGCCGCATACGAGGCTGATGGCGGTGAAGGAAGCAATTCG
AACTCAGCTCCGTTCGTTGCGTTCGGGACTGCGCTGCCGGCGTCGGATTC
CGAGACCAGGGATGATGGGAGTTACGTTCCTGTTTGGAAACAGGAGGTTA
CAGATGAGCGTGGGAGGAAGAGGTTGCACGGGGCTTTCACTGGAGGTTTT
AGTGCTGGGTACTTCAATACTGTTGGGTCTAAAGAAGGATGGACCCCCGC
AACGTTCAAGTCCTCCCGCGGTGCACGAGCGAAGGCTGCCCAAGCCCGGC
CCGAAGACTTCATGGATGAGGAAGATCTCAAGGAAGCCGCGGAAGCACAG
GTTGTCGAAACGGCGTCCGGGTTTTCTGGGATTGGGTCTACGGAAGAGGA
GCTCGGCCGGAGGGCTAGACAGGTTACTCTAATGGACCTTCTCACGCCTG
CTGTGCAGGATACGATGGGCGCCAAGCTTCTGAAGAAAATGGGCTGGAAG
GAAGGGCAAGGTATTGGCCCCAAGGTCCGGAGGAAGGCTGTGATTGATGA
TGCCGTGGACGACACCGGGAAGACCTATTTTTTTGCACCGACAAATAGTG
CAATTGTTACGCTCACACGGAAGAATGATTCTAAAGGACTGGGGTTTGTG
GGCGAGGAACGCCTACAGCAAGGGAAAGAACTAGAGATCGAGCGTCCGGC
TGTGAAGGAGAAAAAGAGGAGGGGTGGTGGGTTTGGT

Sequences in the Contig:

SY0AAA55YD21FM1 SY0AAC44YM04FM1 SY0AAC8YA10FM1