Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1566
Length(NT) : 1275
Best Gene Model Blast : Link to GSTUMT00011842001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_03872
Accession: ref|XP_001595782.1| Score: 552 E_value: 2e-54
KEGG Definition: hypothetical protein
Accession: ncr:NCU01404.1 Score: 542 E_value: 1e-53
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0838 Score: 268 E_value: 3e-24
PFAM Definition: SpoU_methylase, SpoU rRNA Methylase family. This family of proteins probably use S-AdoMet..
Pfam Number: pfam00588 Score: 288 E_value: 1e-26
Swissprot: P25270|MRM1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0008989 = Molecular function: rRNA (guanine-N1-)-methyltransferase activity
GO:0000154 = Biological process: rRNA modification

Sequence:
>Contig1566
TTGGCAGCAATGAACACCCCCCAATCAGCTCGATTATTGCACAAAATCCC
TATCAAGATACTCTACAAACCTCTACACCGATCGGTCTCCACAGATTCTG
CCATCAACCGTGGTCTCCGTCGTTCAGCTGCTGCAGATCGTTACTATGGC
TGTCAAAAGGACACTCGCGAGTACGACTATAGCCCTGAGCCTGCAATCTA
CCAAAATTCCCCCCCACCCCTTGATCCCACAATCCGACGGGTTGTCGCTA
GAAGAGAGGGAGAACCTAAGGGCGATTACTTTGAGCTAGAACCAAGACGA
GAACTATCACCCCGTCTTGACCACGAACCCCCTCAATTCGGTTACACTCC
CGCCCCCCGTCGATATATACCAAAAGTAAACTACGATGCGGAATGGATAT
ACGGCACCTCTGTCGTAGAGGCTGCTCTAAGGTGCAAACGAAGGGAACTA
TACAAACTTTACGTCTACGCAGGCGATAACAGAACACCCGCCGCTCGGGA
GCGGGACCGGGACATGAAGGATCTGGCACGGACCGCAGGTGTAGAAATTG
TCGACGAGGAGGACATGGGGAAGATGGATAGTATGAGTAACTCGAGGCCG
CATAATGGCTATGTTCTTGAATGTCTACCTATAAAAAGAACCCCTATTAT
AGCACTTAAAGGCGTCCAAGAAGATAGAAACTTCTTTACATTGGAGATGG
CCAGACATTATTTCGACGGCCGGCCAGTGACCGAACACTATTATGATAAG
ATTCGCTGCAGGGATCCAAAAAGAAGATACCCATTCGTTCTCATGTTGGA
CGAAATATTGGATCCCGGCAACATGGGGGCCATCCTCCGCTCAGCCTACT
TCCTGGGTGTAGATGCTGTGACCATTACGGCAAGAAATTGCGCCCGACTC
TCACCCGTCTGTCTAAAAGCCTCCGCTGGAGCCGCGGAACTCCTCCCAAT
ATTCGAGCACGCAAAAAGTGAACGCATGATAACCCAGTCCACGGAAAATG
GCTGGACCGTCTACGCCGCCATCCCACCGCCAACGAAGAACCAAGCCCGC
AGAGATCGATACGTCTATGCTCCCGAAGTGGCTGAGGTAGTTAAGGAGGG
CCCCGTAGTGCTGCTCGTGGGCAACGAGGGGGAGGGTCTCCGACCACCGT
TGAAGAAGTTGGCCAAGTTTTGTGTTAGTCTGGTTAAGGGGCCCGGTACT
GACAGCTTGGTGGATTCATTGAATGTTAGCGTTGCGACGGCGTTACTCTG
CTCGAAGTTCCTGGGGGCCTGATGG

Sequences in the Contig:

SY0AAA19YD15FM1 SY0AAA41YJ12FM1 SY0AAA42YG18FM1
SY0AAA55YD07FM1 SY0AAB6YI02FM1