Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1565
Length(NT) : 2505
Best Gene Model Blast : Link to GSTUMT00005727001 E-value : 0.0
Numbers of ESTs : 22

Blast Results:

Nr Definition: importin alpha subunit
Accession: ref|XP_001538850.1| Score: 2084 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: fgr:FG07141.1 Score: 2028 E_value: 0.0
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0166 Score: 1769 E_value: 0.0
PFAM Definition: IBB, Importin beta binding domain. This family consists of the importin alpha (karyopherin alpha), importin beta (karyopherin beta) binding domain. The domain mediates formation of the importin alpha beta complex; required for classical NLS import of proteins into the nucleus, through the nuclear pore complex and across the nuclear envelope. Also in the alignment is the NLS of importin alpha which overlaps with the IBB domain..
Pfam Number: pfam01749 Score: 214 E_value: 1e-17
Swissprot: O14063|IMA1_SCHPO
Gene Ontology:
GO:0005635 = Cellular component: nuclear envelope
GO:0005525 = Molecular function: GTP binding
GO:0030674 = Molecular function: protein binding, bridging
GO:0030261 = Biological process: chromosome condensation
GO:0000087 = Biological process: M phase of mitotic cell cycle
GO:0006607 = Biological process: NLS-bearing substrate import into nucleus
GO:0007346 = Biological process: regulation of mitotic cell cycle
GO:0006950 = Biological process: response to stress

Sequence:
>Contig1565
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCACCCTCACCCTCACAA
AGCGAAGGGATAGAAATTTTAATAATCTCATTCATAGCTTGCAAATCGTT
CTATCCTCATCTCCTCTCACCCGCCCTGCCCTGCGTTCTGTAGCAGTTGG
TGGCTGTTTTCTGCCTTTCTTCCATAACCCTTTACCCCCACTGCTAGGTT
ATCGTTGCTTATCCCCCCCCGTCTCACACCTCCGCACCCCTCATCTTCCT
CTCACCCCGCCACCAGCCTGCTTCCCTTCATCAACCAACACGAATTCTTC
TAACAGCAGCAACAACAAAATCAATCTTTCACCAAAAACATCCGTCAAAC
ATGGCCGACCGATACATTCCTGAGCATAGACGCAACTTTAAGGCGAAGGC
CAACTTCAAGCCCGATGAGTTGAGACGTCGTCGCGAGGAGCAGCAGGTGG
AGATCCGAAAGCAGAAGCGGGAGGAGAATCTGGCAAAACGGAGAAATATG
GCCGTAACTAGCCCTGCACCCGGAGCTGGCGTCGATAGCGACGAAGAGGG
AGGAACCGAATCACAGCTAAACGAGGACCTCCCGTCTATGTGCGCCGGTG
TTTTTTCTGAATCAATTGATCAACAAATTCAGGCTACCACCAGATTCAGA
AAACTTTTGTCGAAGGAGCGCAATCCTCCCATTGAGAAAGTTATCGAATG
TGGCGTGGTTTCTCGCTTCGTAGAATTTCTTCGCTCACCCCATACTCTCG
TTCAATTTGAGGCGGCTTGGGCTTTGACCAATATTGCGTCCGGATCTGCA
TCACAGACTCAAGTTGTCATTGAGGCTGGCGCTGTTCCCATTTTCGTCGA
CTTGTTATCTAGCCACGAGCCAGATGTTAGAGAGCAGGCTGTTTGGGCTC
TGGGTAACATTGCTGGTGATTCGCCACAATGCAGGGATTTCGTTTTGTCT
GCTGGTGCTCTGCCACCTCTGTTGAGCCTCTTGGGCGATAGCCGGAAGTT
GAGCATGCTTAGGAATGCTACTTGGACGTTGAGCAACTTTTGCCGTGGAA
AGACCCCTCAACCGGATTGGCCTACGATCCTTCCGGCTCTTCCGGTCCTC
GCAAAGTTGGTGTATTCTCTGGATGATGAAGTCCTGATTGACGCCTGTTG
GGCTATTTCTTATCTATCGGATGGCTCCAATGATAAGATCCAGGCGGTCA
TTGAGAATGGAATTCCGCGGCGCCTTGTCGAACTTTTGATGCACTCGTCT
ACCTCAGTTCAGACTCCCGCCCTTCGCTCAGTTGGTAACATCGTTACCGG
AGATGATGTGCAAACACAGGTTATTATCAATTGCGGCGCTCTCCCTGCCC
TCCTAGCTCTGTTGGGTTCGCCCAAGGATGGGATCCGAAAGGAGGCGTGT
TGGACTATTTCCAACATTACCGCCGGGAATTCGACCCAGATCCAGGCGGT
CATTGATGCCAACATAATCCCCCCACTCATCAACCTCCTCTCGCACGGCG
ACTTTAAGACCCGTAAGGAAGCTTGCTGGGCAATTTCGAATGCAACTAGT
GGAGGACTCCAAAAGCCCGAACAAATTAGATATCTCGTTTCTCAAGGATG
CATCAGACCTCTTTGCGACCTTCTCGGGTGTATGGACAATAAGATCATTC
AGGTTGCCCTCGATGGTCTCGAGAATATCCTGAAGGTTGGCGACATGGAC
AAGAACGCTGAGACCGACAACATGAACCGTTATGCTATGTTCATCGAGGA
GGCTGGTGGAATGGAGAGGATCCATGCCGCTCAAAATAATGCCAATGAGG
AAATCTACATGAAAGCGTATAACATCATCGAAAAGTACTTTTCTGATGAG
GACGATGAGACCGGGGCGGAGATTCAGGGATTGGCTCCCCAACCCCAGCA
AGATGGCCAAGCTGGTACCTTTAGCTTTGGTGCACAACCGCAGCAGGGGG
GCTTCAACTTTGCCAATGGGGATAGCATGGACATGTGAACCATTCTCGCC
ATCAACGGATACCAAAAAACAAACTGCTTGGGAAAACGCAATAGAGGGAA
TCAATTTGTGGAGGTGTTTTAAAAGCACATTATTGACTGTTTTTCTTCGG
ATAACTTACACTTTCTCTCATTTGGTTCGGGTTTCTGAGCTTTTCTCTTT
GTCTACCTTTTTTCCTTTCCTGTTTCTCTCTTTTTTTGTTTCTCCTTTTT
TTTTTCCCCACAAATGTTTTACTCTAGGGCCGGCATTCTCTTAGGTGGAG
GAGGGGCAAGTAGGTGGTTGGTGGATGGTTCGGAAGAAACGAGCAAAAAA
ATGAGAAATGAGGAAAAAGAGAATCAAAGGGAAACGCTTTAATTGCTATT
TGTACCAGCTAACCAGAAAGTGATTTCTTTCCTTCATCCTCATTTCCCCT
ATCCTGAATATTTTCTGCGCTGTTCCACGTCTTCTATTTATCATTTTTTT
TTTTGCAACTATGACACCCCCATCCGTCCATCCGTCCATCCGTCATGTTT
TCCTT

Sequences in the Contig:

SY0AAA15YG17FM1 SY0AAA28YM04FM1 SY0AAA55YC10FM1
SY0AAB13YB05FM1 SY0AAB29YC07FM1 SY0AAB34YP09FM1
SY0AAB39YJ03FM1 SY0AAB3YP02FM1 SY0AAB46YH03FM1
SY0AAB52YI02FM1 SY0AAC13YK18FM1 SY0AAC31YJ05FM1
SY0AAC45YA18FM1 SY0AAC52YK24FM1 SY0AAC59YE09FM1
SY0AAC61YB18FM1 SY0AAC8YM11FM1 SY0AAC9YF19FM1
SY0AAD19YB09FM1 SY0AAD19YG11FM1 SY0AAD19YM19FM1
SY0AAD4YI01FM1