Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1564
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00001589001 E-value : 5e-13
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_09028
Accession: ref|XP_001590264.1| Score: 192 E_value: 2e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG05557.1 Score: 177 E_value: 7e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1564
AAGCTATACTGAAAGCATTATTGCTGTTCAACCAGACTTTACAAAATGCT
CAAGGACTCTTCCCAAAAACTCTAAGTGAGTCGTTACTAAAGTTGAAATC
CCAATCTCTCTTGCAAGACCCAGACCTTCTTGGCCTGGCTGAGTTAGGAT
TAGGCTCCAATGGCCGGTGGCTGCCGGAGCAGGTTCGAGATTTTATCCCA
TGGGTTCGCCATGATGATCTAGAGAGGTCTCGTGTGGTAGAACAAGGGAA
ATCATGGGCAACAAAGGAATTGGAAAATTTAAACATTGCTTTCGAGAAAT
CACTGCAGGGTATTGAGGATATCAGGGAGCTGGTGGCTCTACGAGAAAAT
ATTCTCGGGCTGTGGAGAACAGGAAGAAAGGGGAGAAGGGAATTCTTACA
AAAAGGAGAGAAGTTTCGAGAACTTACTACCGCCAGATTGGCAGAGGTAT
TAAGAATCAAAATTGACGGTCTTGCAGCTATTGGCCATGAGCTTGGTGAG
CTATTGGAGGGTGTTGACGGTGTGGGTAAAGACTACAGCGTCAGTCTTTG
GTCTGGTTCGTTATCGTCAATGGGCCTCGCAAATGGTGGATCCGCATTTA
AGGAGG

Sequences in the Contig:

SY0AAA55YC01FM1 SY0AAC62YJ17FM1