Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1563
Length(NT) : 1103
Best Gene Model Blast : Link to GSTUMT00007378001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein SS1G_05843
Accession: ref|XP_001592921.1| Score: 584 E_value: 3e-58
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_01210 Score: 527 E_value: 5e-52
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4207 Score: 108 E_value: 9e-06
PFAM Definition: No Hit Found
Swissprot: P53721|YN89_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1563
TACCCCGTTGTCCCATTTCCAAATGCAATTCTAACTCACTATTTTGGTTC
TCACGAAGGAGCAAGAAGGAGAGCACTACGCTGCCGTCCTCAAGGGCGGA
ATCTCCGGCGGTCTGGTGGGGCTAGGAGTTGGTCTCGGTGCCGCAGCGGT
CCTCAACCGCCGCTGGCAATTATTCCGTAGCCTCACGCTCCCGCTGAAGG
CCTTCTTCGTCAGCAGCTCGGGCACCTTCGCCGCCATCATCAATGCCGAC
GTCTACTCCCGCGGCTACGAGGCCTCACGCCACGCCGAGCTCCGCGAGTA
CAAGGACTCGGCGGCGCGCGCCCTCGCCATGGCTAGGGCCAACAGGACGG
GCTGGGAGAGGTTCAAGGACTTTGGCCGGGAGAACCGGTACCCCATCGTC
ACGGCGGGCTGGGTCGCCAGTATGGCCGTAAGCTTGGGGCTCGTCAGTCG
CAACAGGTACCTCACCACCAGCCAGAAGCTGGTCCAGGCGAGGATGTACG
CCCAGGGCCTCACCCTCGCCCTGCTCATCGCCAGCGCCGGGTTCGAGGTG
GCGGATGCTAGGAGTGGCAAGGGGAAGTTTGAGACGGTGCTCGTTGTCGA
CCCCGAGGACCCGAAGCATAGGCATATGATTGAGAAGAGGATACACCACG
AGAGTTACTCCGGCGAGGATCTATGGAAAGATATGGTCGAGTCGGAGGAG
CGAAGGCTCAAGGAGAGGGAGGCTGCTCGGGCTAGGGCTAGGGCTAGGGT
TGATTAGATGTTAGATGTTATGATAAATGCTAGATGGTCTTGGCCCCAGC
AGGGCATTCTTGTGAATAGTTTTATGGGGGCAATGCGGTCCGGTCTTTCC
TTTCCCCTTTGCATTTCTCTTGCGATACTTGGTTTGGCTAGGTGGTCATT
AGAGTTATTTCTTGTGTGGTGCTATGCCGTTTCCAGCGTTTCATTTTCTC
CTTTGCTCATGGCTCTCCTCATCCGTTTGATGGCTAAACGCCACCCTTCT
TGATATCTCTAAGTTCATGTATTTCTATGTATGGGGATACTCGTAAAGAT
AAAGGTGTTATAATAGATTTTTATTCTTTTTTGATAGAGTATTTTTTTAC
TCA

Sequences in the Contig:

SY0AAA31YB21RM1 SY0AAA43YP13FM1 SY0AAA55YB05FM1
SY0AAA5YJ16FM1 SY0AAB12YD18FM1 SY0AAB14YP14FM1
SY0AAB20YB08FM1 SY0AAB36YF01FM1 SY0AAB49YI03FM1
SY0AAB8YP08FM1 SY0AAC23YL02FM1 SY0AAC51YH24FM1
SY0AAD29YM10FM1 SY0AAD46YC23FM1 SY0AAD50YK20FM1