Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1562
Length(NT) : 1416
Best Gene Model Blast : Link to GSTUMT00011739001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_03781
Accession: ref|XP_001595692.1| Score: 533 E_value: 3e-52
KEGG Definition: hypothetical protein
Accession: fgr:FG08981.1 Score: 495 E_value: 4e-48
KOG Definition: No Hit Found
PFAM Definition: Opi1, Transcription factor Opi1. Opi1 is a leucine zipper containing yeast transcription factor that negatively regulates phospholipid biosynthesis. It represses the expression of several UAS(INO) cis acting element containing genes and its activity is mediated by phosphorylations catalysed by protein kinase A, protein kinase C and casein kinase II..
Pfam Number: pfam08618 Score: 596 E_value: 3e-62
Swissprot: Q01306|CCG8_NEUCR

Sequence:
>Contig1562
TTGGTCGAGATCGTTATCCATTCAGTCTTTGATATCTTCACCGGAATTGA
CCCCCCCAACATCATATTCGAATAATGATGGGCAATCGGGCACACGGAAA
AGAAAGGGTAGTGACGGGGATGTCGGGGGTTCGCATGGGACTCGCAGCGG
TAGCATTGTCTCCACGACTGTTACCATGGATGATCCGGAGGTTAGAGAGG
TGGTCGAGGCTTTAGGCGGACTGAAGGGTGACTTCACTGCGACATCGCCT
ACCACCGCCAATCATCAGCTTCCCCCACACCAACGTAATCCATCCGGAGT
TGCCGAGAAACAGCAGCCACAGCATCAGCATCAGCAGCAGCAACCAGAAC
ACGAACCACTCATTAATCTTATTACCTCTTCCGCACAGCGGGCTCACCCA
TTGATCTCCTCTGTGATCACTACGGGTCTCTCCGCTTACGGTGCTTCCAA
GTCATACTCCCCCTCCTTCCGTTACGCCGCCGAGTCAGTGGAGAGCCGAG
TTGGGGTGCCAGTTGGAAACGTGGTATCGGCAGTTGGACGGCAAACCGGA
TTGGACAGTGCACTAAGGAGGGGTTTGGGAGGGAACCGGAGGGCCAGCTC
GGGCGGGGAACAGCGTGCGGATACAAAGAAGAGGAAAACGAGCAATAAGA
ACGGAGATTTGCAGAAGGGCGAGGAAAGTTTTAAGATCTTGGCTCAGCAG
CGGAAGCAACAGCAACAGCAGAATACGTTAGCCAGGATGAATGGTGGAAG
TGATCGGGCTCTTGACGAGGGCGCGAGTGATAGGCAGATTGCGGCTCCGA
ACCAGACCTGGCCCACTCGGGTGGTGCTTAGTACATATGGGTTTGGCGCG
GCGTTGAATGAAGAGAGCCTGAAGAATCTGAAATACTGCTTGGACTGGCT
TCGCTTCTTGAATGCGCACTTGGGGAAGCTAGTTTCTGCGTTAAAAGGCG
TTGTTGAAGAATTGGACGATCATCGACGGTCCCAAATGGATGAGGACAGG
CATGCCAACGGTGGGATAGCTCGAGCTCTCCCCACCTCGTACGAGAACTC
GCGAGCCGTCCTTGCAGCAAAGGTTGAGAGTCTGAAGGGCGATGTAGTCG
CCACGATGAAGAAAGTGGTGGAGGTAGTGAGCAACTACACTGGGAGTGCT
CTACCGGAGAATGCCCGAGAGTTGATTAAACGTCATATATTTGCCCTTCC
ACAACGTTTCCAAGCCGCCAATGCCTCGGAACTCGCCGAGAAGGAGAAAG
ATGGTCCCATGTCTTCCGCTAGCAGAGCGCTAGTTTTGGCGAAGGAGGGT
CTCGACATGATGCAGCAGGTTAGCGCTGTTGTCGAGGGGACCATTGATCG
AGCGGAGGAGTGGTGCGAGAGGTTGGGGAGGAAGAAGAGGGAGGATGATG
GACAGAGTGGTGGGGA

Sequences in the Contig:

SY0AAA54YO17FM1 SY0AAB30YE18FM1 SY0AAB60YH15FM1
SY0AAC10YK01FM1 SY0AAC56YA20FM1 SY0AAC6YA12FM1
SY0AAD41YG08FM1 SY0AAD43YB10FM1