Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1561
Length(NT) : 1181
Best Gene Model Blast : Link to GSTUMT00003627001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein BC1G_14242
Accession: ref|XP_001547359.1| Score: 763 E_value: 5e-79
KEGG Definition: hypothetical protein
Accession: fgr:FG02420.1 Score: 721 E_value: 2e-74
KOG Definition: No Hit Found
PFAM Definition: Methyltransf_12, Methyltransferase domain. Members of this family are SAM dependent methyltransferases..
Pfam Number: pfam08242 Score: 125 E_value: 1e-07

Sequence:
>Contig1561
TTGGATTTGCGTGGTTTATGGATAGGCATATATATATTGGCGGGTTGCGG
GTTAAAATGGGTTAATAAGTGCCCTTGAAGGCCCTCCCATAGTCCAACCC
TGAATAGCTACTAGACTTGTTTTTCACTACCGACAACTCACTACTCTCAG
GTCTTATATGCCCTACTCAGGTGAATGGCCCACAACCACGATCAAAGTTC
CACAAGTGCTGGAGCCAACATGTCTTCGTCACTCCAACCTAACGCAGCAC
CTTCTATTGAGACTGGACTCTCAACGGAAAGCTCAAGCCAAGAAGGATTA
CAAAATTACCTTATGGAAGCGGATAGTTTCCCCCCAGATCTCTCGGACGA
TCAGGGGATTGGTGACGATTTATCCACGTATACTGCTTCTCTTTCCTCCA
GCGTGTTGAATTATCAATACGAAAACGGTCGCAGATACCATGGCTATCAC
CGAGGAAACTATGTATTTCCGAATGATGAGCAAGAAATTGAGCGGCTCCA
GTTACAACATCATATGATGGCTATTCTATTCAGCGGAAGGCTGTACTGGG
CACCCATTGATCCCAATCCACAAAAGATCCTGGACATCGGCACTGGCACC
GGAGCTTGGGCAATGGATATGGCGGATATGCATTCTTCAGCCCACGTTAT
CGGGACGGACTTAAGCCCTATCCAACCCGGCTGGGTTCCGCCGAATCTAT
CCTATGAGATTGATGACGCAGAAAGCGAATGGACATACGGGGGAAAAACT
TTCGACCTTATCCATACCCGCTATTTGACAGGATCATTCGCGGACTGGCC
AAAATTCATAGAAAGATCATTCCGAACTCTAACGCCCGGGGGGTGGCTTG
AGTGCCAAGAAATTGATAGCCGTATCCTCTCTGATGACGGGACCCTCCTG
CCAGACTCAGCCCTTGCCAGATGGAGCCGACTTCTCCACGAAGCAGCAGA
AATTTATGGACGCAGCGTTGTAGTAGCCTCTAAATTAGCGGGTTGGATGG
AGAATGCGGGATTCGTGAACGTTACCAACCGATGCTTCAAGCTCCCGAAC
AATGCTTGGCCTAAAAACTCCAGAATGAAAGAAGTAGGAATGTACCAAAT
GGTCAACTTCCTGGACGGCTTGGAGGCTCTCACGATGGCGCTGTTCACAC
GGGCACTTGAGTGGACACCAGACGAGGTGAA

Sequences in the Contig:

SY0AAA35YB03FM1 SY0AAA37YM19FM1 SY0AAA54YO06FM1
SY0AAA59YG19FM1 SY0AAA9YK21FM1 SY0AAB10YB03FM1
SY0AAB16YP07FM1 SY0AAB25YN21FM1 SY0AAB29YE07FM1
SY0AAB50YI24FM1 SY0AAB52YP13FM1 SY0AAB55YF02FM1
SY0AAB61YG04FM1 SY0AAB6YP10FM1 SY0AAB7YL07FM1