Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig156
Length(NT) : 941
Best Gene Model Blast : Link to GSTUMT00011409001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: chromatin regulatory protein sir2
Accession: ref|XP_001266822.1| Score: 772 E_value: 3e-80
KEGG Definition: histone deacetylase SIR2, putative [EC:3.5.1.-]; K01463
Accession: afm:AFUA_4G12120 Score: 763 E_value: 2e-79
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG2684 Score: 621 E_value: 2e-65
PFAM Definition: SIR2, Sir2 family. This region is characteristic of Silent information regulator 2 (Sir2) proteins, or sirtuins. These are protein deacetylases that depend on nicotine adenine dinucleotide (NAD). They are found in many subcellular locations, including the nucleus, cytoplasm and mitochondria. Eukaryotic forms play in important role in the regulation of transcriptional repression. Moreover, they are involved in microtubule organisation and DNA damage repair processes..
Pfam Number: pfam02146 Score: 378 E_value: 4e-37
Swissprot: Q6FWI7|SIR2_CANGA

Sequence:
>Contig156
TTGGCAGGAGGTTTTCGACCTAGATGTTTTCCGTGAAGATCCCACTATCT
TTTATAGCATCGCAGGGCGTATACTCCCAACCATAGACCGAATATCCCCA
ACGCATGCATTCATCGAACTCCTCCAGCGTAAAAATAAGCTCCTCACGCA
ATACACACAAAACATCGATAACCTAGAAATCAAGGCGGGTATCGATCCAG
AGAAGCTCATCCAATGCCACGGATCCTTCGCCTCCGCCAGTTGTGTGCAA
TGCGGTCACAAAGTCCCCGGTGAGACAATATTCCCGGATATGATCAAGGG
GATAGTACCCAAGTGCGAAGCCTGCTTGAAACACAATGCCAACAACCACA
ACAACAGCAAAGTTGGCAGAAAGCGCAAGAGAGGAAAGAACAATAGTGAG
AGGACATCAGTAGACTACAGACGTAAGAGGTACGACGAAAGCAGCGATGA
CGAGGGCGGGGACGACATTCCACAAGCTGGTGTTATGAAGCCAGACATAG
TCTTCTTCGGCGAACAACTCCCGGCAACCTTCAACAAACGCCTAGTAGAC
CACGACCGGGCGCGCTGCGACCTCTTCATCTGCATCGGCACAAGCTTAAA
AGTAGCACCCGTATCCGAAATAATAGGAATCCTACCACCGCATGTTCCTC
AGATTTACATTTCGAAAACGCCTGTCACGCACGTAAACTTTGACATAGAG
CTTATCGGCTCCTGCGACGATGTGGTTGCCGAACTCAGTCGGAGGGCTGA
GTGGGACTTGAAGCACGATATGATTCCCGAGGATCAGGAGAAGATTGCTA
GGATTCGGTTGGAGGAGGGGAGTGTTTCTAGGTGGATTTTTGGGGAAGGT
GGGAAGGGTGAGGAGGGTGAGGAGGGTGAGGGGGAGTAGATTGTCTCATG
GCCTATGGATGGCTTAGCTAAACTTGCTTTTATACCCTACT

Sequences in the Contig:

SY0AAA15YM11FM1 SY0AAA50YD21FM1 SY0AAB26YD07FM1
SY0AAB42YH17FM1 SY0AAB46YG23FM1