Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1559
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00006680001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN5336.2
Accession: ref|XP_662940.1| Score: 643 E_value: 2e-65
KEGG Definition: hypothetical protein
Accession: ani:AN5336.2 Score: 643 E_value: 8e-66
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P21589|5NTD_HUMAN
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0008253 = Molecular function: 5'-nucleotidase activity
GO:0006259 = Biological process: DNA metabolic process

Sequence:
>Contig1559
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTTGCCCTCTAGAGCGA
GGGGAAATTTGACGAACTTGAGATTCTCTTGCCGTTATCATTGACTAAAA
CATCCACTTTCCAACTACTATTTACTACCTTGCTATTTCCCCCCACCATG
GCTGACACCGCTACCTCAAGCATTACTTACTCCTCTGGAGCGACTGGTGA
ACCGGATTTGCGTTTTTTACATTATAATGATGTCTACCACATCGATGCTA
GCTCCCGTGACCCTGTCGGCGGTGCCTCCCGCTTCGTAGCCTTAGTAAAC
CACTACCGTTCCTCCAGTGAGTACGACGGTCAGCCCTCCCTCTTAACCTT
CTTCTCGGGCGATGCCTTCAACCCCTCTCTGGAATCCTCCGTGACCAAGG
GCCGGCACATGGTGCCCATCCTGAACCAAATCAAGACCAGCGTGGCCGGT
CTCGGGAACCATGATCTTGACTTTGGTGTCGACCAATTTACCTACTTGGC
AAAGCAGTGCGAGTTTCCCTGGCTTTGTGCAAACGTTGAGGATCCTGCAC
TCGGCGAGGGCGTGAGCATCGGCGGCTTGCCAAAGACGGTTATTTTAGAG
AGTAGTAATGGATTGAAAGTTGGAGTTATTGGGCTTGTTGAGAGGGAGTG
GCTGGACACGATTAATTCTCTGCCACCTAATTT

Sequences in the Contig:

SY0AAA4YL02FM1 SY0AAA54YN13FM1